ID: 1096786446

View in Genome Browser
Species Human (GRCh38)
Location 12:54019547-54019569
Sequence CCATCAGCGGCCATCCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096786446 Original CRISPR CCATCAGCGGCCATCCACAG GGG (reversed) Intronic
900581034 1:3409355-3409377 CCATCAGCAGCCCTCCAGAGAGG + Intronic
901813961 1:11783532-11783554 CCATCTACGGCCAGGCACAGTGG - Intronic
902718149 1:18286892-18286914 CCATCTTCGGCCAGGCACAGTGG + Intronic
903004358 1:20288912-20288934 CCATCAGCCCCGCTCCACAGGGG - Intergenic
903723646 1:25424673-25424695 CAATCAGAGGCCAGGCACAGTGG - Intronic
906253941 1:44332915-44332937 CCATCACTGGCCATCAATAGAGG + Intronic
906517959 1:46450623-46450645 CCATTAGCGGGCAGCCAGAGGGG + Intergenic
908510692 1:64847985-64848007 CCATCAACAGCCAGCCACATGGG + Intronic
908935012 1:69364396-69364418 ACATCAGTGGCCAGCCACTGAGG - Intergenic
912534189 1:110352515-110352537 CTATCAGAGGCCAGGCACAGTGG + Intergenic
912979921 1:114362165-114362187 CCATCATGGGCCAGTCACAGTGG + Intergenic
915272134 1:154760810-154760832 CCATAAGCGGCCGGCCGCAGAGG + Intronic
918290135 1:183099449-183099471 CCATCAGCTTCAAGCCACAGAGG - Intronic
919085114 1:192911856-192911878 CCAGCAGCGGCAACCCACTGGGG + Intergenic
1063186582 10:3657378-3657400 CCATAAACCGCCATCCACATAGG - Intergenic
1063226904 10:4024331-4024353 CCATCAGCCGCCATCACCACCGG + Intergenic
1068790451 10:61025074-61025096 CCATCAGCGATCATCCTTAGAGG - Intergenic
1069808760 10:71143114-71143136 CCATCACCGGGCATGCCCAGTGG - Intergenic
1069934490 10:71905934-71905956 CCATCAGCATCCATTTACAGCGG - Intergenic
1073968579 10:109020237-109020259 GCATTAGCGGCCAGGCACAGTGG + Intergenic
1076837622 10:133029042-133029064 CCATCAGAGGGCATCTGCAGAGG + Intergenic
1077958846 11:7051249-7051271 TCCTCAGTGGCCATCCACACTGG - Intronic
1082218161 11:49600211-49600233 CCATCAGAGGCCAGGCACAGTGG - Intergenic
1086395904 11:86414592-86414614 CCATAGGCGGCCAGGCACAGTGG - Intronic
1086631410 11:89023936-89023958 CCATCAGAGGCCAGGCACAGTGG + Intronic
1096786446 12:54019547-54019569 CCATCAGCGGCCATCCACAGGGG - Intronic
1097583145 12:61482757-61482779 CCATTAGTGGCCAGGCACAGTGG + Intergenic
1097827137 12:64185593-64185615 CCATCTGGGCCCATCCACATTGG + Intergenic
1104317578 12:127718632-127718654 CCATCAGAGGCCGGGCACAGTGG + Intergenic
1106351756 13:28937418-28937440 CCATCAGCGGCAACCCGCTGAGG + Intronic
1106505201 13:30365036-30365058 GCATCAGCAGCCATGCAGAGAGG + Intergenic
1109140400 13:58707769-58707791 CCCTCAGCGGCCACCCACTTGGG - Intergenic
1110714496 13:78685702-78685724 CTATCAGAGACCATCCCCAGTGG - Intergenic
1112418099 13:99221645-99221667 CCATCAGCTTCCATCCTCAATGG - Intronic
1113735038 13:112672472-112672494 CCATCTGAGGCCATGCACAGTGG + Intronic
1114918248 14:27293348-27293370 CCATCTGCGGCCAGACACAGTGG + Intergenic
1125555543 15:40581820-40581842 CCAGCAGCAGCAATCCACTGGGG - Intergenic
1126181424 15:45788616-45788638 CCAACAGAGGCCAGGCACAGTGG - Intergenic
1129629808 15:77246292-77246314 CCAGCAGGGGCCAGGCACAGTGG - Intronic
1130846755 15:87754888-87754910 CCACGAGAGGCCATGCACAGAGG - Intergenic
1130938836 15:88491257-88491279 CCAGCAGCTGCCACCCTCAGAGG - Intergenic
1132637438 16:959000-959022 CCACCGTCTGCCATCCACAGTGG - Intronic
1132811892 16:1803854-1803876 CCATCAGGGGCCAGACACAGTGG - Intronic
1133112078 16:3554102-3554124 GCATCAGGGGCCATCCAGATGGG + Intronic
1135682671 16:24471762-24471784 CCTTCAGCTGTCATCCACCGTGG + Intergenic
1136265831 16:29117524-29117546 CCAACAGCGTCCCTGCACAGAGG - Intergenic
1140975003 16:80051246-80051268 CAATCATTGGCCATCCTCAGAGG + Intergenic
1141149246 16:81552767-81552789 CCACCAGGGGCCATCCTTAGTGG + Intronic
1141223270 16:82091329-82091351 CCATCAGTGTCCATGCAGAGGGG + Intronic
1141403005 16:83767205-83767227 TCATCAGCTGCTATCCACATCGG - Intronic
1141969528 16:87471629-87471651 CCACCAGGGGCCAACCACATGGG + Intronic
1142054649 16:87985431-87985453 CCAACAGCGTCCCTGCACAGAGG - Intronic
1142506279 17:365264-365286 CCATCAGCAGCCGGGCACAGTGG + Intronic
1142997524 17:3769580-3769602 CCATCAGCTCGCAGCCACAGGGG + Intronic
1144336756 17:14278365-14278387 CAATCAGAGGCCAGGCACAGTGG - Intergenic
1145880343 17:28348303-28348325 CCCTCAGCTGCCAGCCACAGAGG + Intronic
1147177022 17:38662313-38662335 CCAGCACCTGCCCTCCACAGAGG + Intergenic
1149451540 17:56753748-56753770 TCCACAGCTGCCATCCACAGAGG - Intergenic
1149972972 17:61237452-61237474 CCAGCAGCGGCAACCCACTGAGG + Intronic
1150270962 17:63864718-63864740 CTTTCAGCGGCCAGGCACAGTGG - Intergenic
1150317933 17:64185634-64185656 TCATCAGAGGCCAGGCACAGTGG + Intronic
1150345806 17:64403847-64403869 TCATCAGCAGCCTACCACAGGGG + Intronic
1151027558 17:70696656-70696678 CAATCAGCAGCCATCAACAATGG + Intergenic
1151231503 17:72688471-72688493 CCTTCAGCTGCCCTCCACTGGGG + Intronic
1151560735 17:74868163-74868185 CCATCCCAGGCCAGCCACAGGGG + Intronic
1155590944 18:27426548-27426570 TGATCAGCAGCCATTCACAGAGG - Intergenic
1158585909 18:58734574-58734596 CCCTCAGGGGCCAGGCACAGTGG - Intronic
1158697750 18:59717820-59717842 CCATCACAGGCCAGGCACAGTGG + Intergenic
1158844754 18:61429984-61430006 ACATCAGAGGCAACCCACAGGGG + Intronic
1160654155 19:252687-252709 CTATCAGTGCCCATCCACACTGG + Intergenic
1161436802 19:4268438-4268460 CCATCAGGTGCCATCCAGAAAGG + Intronic
1161683935 19:5693979-5694001 CCAGCAGCTGCCAGCCACAGAGG + Intronic
1162919059 19:13889723-13889745 CCATCAGCGGCCTTCCTCCTGGG + Exonic
1163221866 19:15927500-15927522 CCATCAGTGGCCATGGAGAGGGG + Intronic
1166881555 19:45933556-45933578 CCATCTGGGACCATCCTCAGGGG + Intergenic
1166988120 19:46674484-46674506 CCAGCTGCTGCCCTCCACAGCGG - Exonic
1167796737 19:51714178-51714200 CCCCCAGTGGCCGTCCACAGTGG - Intronic
1168173834 19:54608578-54608600 CCATCTTCGGCCAGGCACAGTGG + Intronic
926607920 2:14915845-14915867 CCATCAGAGGCCAGGCACAGTGG - Intergenic
928156814 2:28884288-28884310 CCATCAGCGGCCGGGCACGGTGG - Intergenic
929087856 2:38186126-38186148 CCATCAGCAGGCATCCAAAAAGG + Intergenic
930967479 2:57347704-57347726 TTATCAACTGCCATCCACAGGGG - Intergenic
931666799 2:64615627-64615649 CCACCTGCAGCCATCCTCAGAGG + Intergenic
937248693 2:120510257-120510279 CCCTTGGCGGCCATGCACAGAGG + Intergenic
937591269 2:123615516-123615538 CCATCACCACCAATCCACAGAGG - Intergenic
937830210 2:126411764-126411786 CACTCAGCGGCCATCAACAATGG - Intergenic
938144339 2:128821330-128821352 CTAGCAGGAGCCATCCACAGAGG - Intergenic
938811299 2:134855374-134855396 CCAGCAGTGGCCATGTACAGTGG - Intronic
944926511 2:204470769-204470791 GAATCAGAGGCCTTCCACAGTGG - Intergenic
946022594 2:216651329-216651351 CCACCATCAGCCATCCAAAGAGG + Intronic
946225111 2:218260370-218260392 CCATCAAGGGCCATGCACTGGGG + Intronic
947597358 2:231421473-231421495 CTAGCACCGTCCATCCACAGAGG - Intergenic
947899303 2:233707079-233707101 CCCTCAGCTGCCATGCAAAGTGG - Intronic
947912088 2:233808249-233808271 CCAGCACCGTCCATCCACTGAGG - Intronic
948687719 2:239679773-239679795 CCATCAGCAGCCATCAACCCTGG - Intergenic
1172224942 20:33299261-33299283 CCATCCTCGGCCATACACCGGGG + Intronic
1173384212 20:42573291-42573313 CCACTAGGGGCCTTCCACAGTGG + Intronic
1175214156 20:57381746-57381768 ACATCACGGGCCAGCCACAGGGG - Intergenic
1175688694 20:61050080-61050102 CCATCAGCGTCCACCCAGACAGG - Intergenic
1175797384 20:61780352-61780374 CCATCAGAGGCCTTCCCAAGGGG + Intronic
1178280508 21:31278494-31278516 CCAGCAGCGGGCAGCCCCAGGGG - Intronic
1180683901 22:17649788-17649810 TCTTCAGCGGCCAGGCACAGTGG - Intronic
1180971305 22:19817199-19817221 CCATTAGGGGCCAGGCACAGTGG + Intronic
1181262860 22:21611254-21611276 CCCTGGGCTGCCATCCACAGTGG + Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1182755099 22:32672994-32673016 CCATCTGGGGCCCTCCAAAGGGG - Intronic
1184168232 22:42743268-42743290 CCAGCAGCGGCCATCCTGGGTGG + Intergenic
1185345797 22:50310029-50310051 CCATCAGCTGCCCTCCACCAGGG - Exonic
949592988 3:5513069-5513091 CCATCATCGGCCAGGCGCAGTGG + Intergenic
950495273 3:13330118-13330140 ACATCAGTGGCCAGGCACAGTGG + Intronic
954128833 3:48549438-48549460 CCAGCAGCAGCCATCCCCACGGG + Intronic
954277347 3:49551240-49551262 CCATCCAGGGCCATGCACAGTGG - Intergenic
961633951 3:128321385-128321407 CCCTCAGGGGGCAGCCACAGTGG + Intronic
961657392 3:128450775-128450797 CCACCACCTGCCAGCCACAGTGG + Intergenic
964772635 3:160239993-160240015 GCATCAGCGGCCGGGCACAGTGG - Intronic
964954596 3:162336871-162336893 CCAACAGCGGCAACCCACTGGGG - Intergenic
968342974 3:197973535-197973557 CCATCAGAGGCCAGACACGGTGG - Intronic
968531019 4:1091718-1091740 CCATGAGAGGCCATCTCCAGAGG + Intronic
974446118 4:61984417-61984439 CCATCAGTGGCCAGACACAGTGG + Intronic
975907657 4:79233782-79233804 CCATCATGAGCCAACCACAGTGG - Intronic
976437037 4:85030024-85030046 CCAGCAGAGGCCAGGCACAGTGG - Intergenic
979420121 4:120493901-120493923 CCAGCAGCAGCAACCCACAGAGG + Intergenic
979625803 4:122843909-122843931 CAGTCAGCAGCCATCCACTGAGG - Intronic
980833400 4:138158775-138158797 CCATCGGGGGCCAGGCACAGTGG - Intergenic
980941714 4:139280786-139280808 ACATCAGCGGCCGGGCACAGTGG + Intronic
982630300 4:157822548-157822570 CCAGCAGCGGCAACCCACTGGGG + Intergenic
983084694 4:163428476-163428498 CCAGCAGCGGCAACCCACTGGGG + Intergenic
983586177 4:169357280-169357302 CCAACAGAGGCCAGGCACAGTGG + Intergenic
985907773 5:2854394-2854416 CCAGCAGCAGCTATCCACTGGGG - Intergenic
987545610 5:19307424-19307446 CCAGCAGCGGCAACCCACTGGGG - Intergenic
989559804 5:42837178-42837200 CCAACAGCGGCAACCCACTGGGG + Intronic
995433523 5:112109431-112109453 CAATCATTGGCCATCCTCAGGGG - Intergenic
996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG + Intronic
997615817 5:135245582-135245604 GCATCAGAGGCCAGCCCCAGTGG + Intronic
998542635 5:142997314-142997336 CCATCAGTGAACATGCACAGTGG - Intronic
1002893731 6:1361644-1361666 CCACCAGCGCACATGCACAGCGG + Intergenic
1003271889 6:4614601-4614623 CCAGCAGCGGCAACCCACTGGGG - Intergenic
1003358179 6:5395336-5395358 CAATCAGTGGCCAGGCACAGTGG - Intronic
1004573258 6:16868550-16868572 CCACCAACGGCCATAAACAGTGG + Intergenic
1006987244 6:38184144-38184166 CCACGAGCGTCCATCCACAGAGG - Intronic
1006987518 6:38185926-38185948 CCATGAGCGTCCATCCACAGAGG - Intronic
1007642204 6:43350548-43350570 CCATCACAGGCCAGGCACAGTGG + Intronic
1008728729 6:54453740-54453762 CTATCATCTGCCAACCACAGGGG - Intergenic
1014386336 6:120806604-120806626 CCAGCAGCGGCAACCCACTGGGG - Intergenic
1015179358 6:130345341-130345363 CAAGCAGCCGCCATCCACTGAGG + Intronic
1015577440 6:134687229-134687251 CCATCATCGGCCGGGCACAGTGG - Intergenic
1017916025 6:158832166-158832188 CCACCATGGGCCATCCACAGGGG - Intergenic
1024659847 7:51482956-51482978 CCATCATCGGCCAGGCTCAGTGG - Intergenic
1028163691 7:87514184-87514206 CTACCAGCGTCCATACACAGCGG + Intronic
1029020917 7:97364138-97364160 GCAGCAGCAGCCAACCACAGTGG - Intergenic
1029589233 7:101496179-101496201 CCATCTGCTTCCATCCAGAGTGG + Intronic
1032474638 7:132203664-132203686 CCTTGAGCTGGCATCCACAGGGG - Intronic
1033611280 7:142965290-142965312 TAATCAGCTGCCATCTACAGTGG + Intergenic
1035456134 7:159010117-159010139 ACATCAGCGGGCATCCACAATGG - Intergenic
1035474913 7:159136500-159136522 ACATTAGTGTCCATCCACAGTGG + Intronic
1037999842 8:23382228-23382250 CAATCAGCGGCCAGGCACAGTGG + Intronic
1042041810 8:64599473-64599495 CAATCAGCGGCCGGACACAGTGG - Intronic
1042532661 8:69832069-69832091 CCACCCACGGCCAGCCACAGGGG + Exonic
1049038949 8:140098195-140098217 TCATCCGCAGCCATCCACAGCGG + Intronic
1051146925 9:14036808-14036830 CCATCATGGGCCATGCACAGTGG + Intergenic
1051354576 9:16230208-16230230 CCATCAGTGGACATTTACAGAGG - Intronic
1052065362 9:24011954-24011976 CCATCAGCGACAATCCACTATGG - Intergenic
1060384627 9:123213636-123213658 CCACCTGCGGCCAGTCACAGTGG + Intronic
1062442965 9:136579269-136579291 CCATCCCCGGCCATGCTCAGTGG - Intergenic
1187883790 X:23870092-23870114 CCATCAACAGCGATCAACAGTGG - Intronic
1190655190 X:52605870-52605892 CCACCAGCAGCCATCAACACCGG + Intergenic
1192099208 X:68246090-68246112 CCATAACCGGCCAGGCACAGTGG - Intronic
1197050037 X:122046674-122046696 CCATCACCTGACATCCACAAGGG - Intergenic
1197990355 X:132310862-132310884 CCATCATTGGCCAGGCACAGTGG + Intergenic
1200097232 X:153670031-153670053 CCAGCAGAGGCCAGCCCCAGGGG + Exonic
1200962948 Y:9011734-9011756 CCAGCAGTGGCCACCCACGGGGG - Intergenic
1202150482 Y:21839573-21839595 CCACCAGCGCACCTCCACAGAGG + Intergenic