ID: 1096786904

View in Genome Browser
Species Human (GRCh38)
Location 12:54022032-54022054
Sequence TAAACCTCTGGGTGTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096786904 Original CRISPR TAAACCTCTGGGTGTCCCTG TGG Intronic
900511337 1:3062546-3062568 TAGACCCTTGGGTGTCCCTATGG + Intergenic
902985460 1:20151826-20151848 TAAAGCTGTGGGCTTCCCTGGGG + Intergenic
903096155 1:20976347-20976369 TAAACCTCTGTGTGACACTGGGG - Intronic
904903011 1:33872385-33872407 TAAAGCTGTGGGTGTGACTGTGG + Intronic
905876469 1:41434875-41434897 CAAACCTTTGGGTGACCCTATGG + Intergenic
908998015 1:70182386-70182408 TGAACATCTGAGTGTTCCTGTGG + Intronic
913564231 1:120055901-120055923 TGAACCTCTGCCTGTCCCTTTGG - Intronic
913633896 1:120737663-120737685 TGAACCTCTGCCTGTCCCTTTGG + Intergenic
914284818 1:146215250-146215272 TGAACCTCTGCCTGTCCCTTTGG - Intronic
914545849 1:148665989-148666011 TGAACCTCTGCCTGTCCCTTTGG - Intronic
914620714 1:149404677-149404699 TGAACCTCTGCCTGTCCCTTTGG + Intergenic
915635263 1:157181884-157181906 GAAGGCCCTGGGTGTCCCTGTGG + Intergenic
915650532 1:157307328-157307350 GAAAACTCTGGGTGTCCCTGTGG - Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
915664176 1:157429818-157429840 TAAACCACTGGCTGTGCATGAGG + Intergenic
916714488 1:167438122-167438144 TATACCTGTGGGTATACCTGTGG - Intronic
918304068 1:183229698-183229720 CAAACCTCTGGGTCTTCATGAGG - Intronic
920624408 1:207582614-207582636 CAAACCTCTGGGTGTAGCTGAGG + Intronic
923049560 1:230381328-230381350 CTACTCTCTGGGTGTCCCTGGGG + Intronic
923256400 1:232225238-232225260 TAAACCTCTGGGTGAGACAGAGG + Intergenic
1068406291 10:56594070-56594092 TAAACCTGAGGGTGTTCTTGGGG - Intergenic
1069029150 10:63577303-63577325 TAAACATAAGGGTTTCCCTGGGG + Intronic
1069512436 10:69052454-69052476 TTAATCTCAGGGTGTGCCTGAGG + Intergenic
1077186436 11:1237403-1237425 TGAGCCTCTGGGTGTGACTGAGG - Intronic
1077336841 11:2009090-2009112 TGGACCTCTGGGTGTGTCTGAGG + Intergenic
1078084583 11:8225962-8225984 TAGCCCTGTGGGAGTCCCTGGGG - Intronic
1078710287 11:13784479-13784501 TAGAACTCTGGGGGTCACTGAGG + Intergenic
1080421125 11:32111381-32111403 TAAACCCATGGTTTTCCCTGTGG + Intergenic
1081668443 11:44930070-44930092 TGCACCTCTGTGTGTTCCTGGGG - Exonic
1083229774 11:61309136-61309158 GAATCCTCTGGTTGCCCCTGTGG + Intronic
1085972612 11:81611693-81611715 TAAACCTGAGAGTGGCCCTGTGG + Intergenic
1086046107 11:82533853-82533875 TAAACCTCTGGACATTCCTGTGG - Intergenic
1086434644 11:86769493-86769515 AAAACTTCTGAGTGTCACTGAGG - Intergenic
1090402019 11:126454986-126455008 TGAATCCCTGGCTGTCCCTGTGG + Intronic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1202819825 11_KI270721v1_random:64272-64294 TGGACCTCTGGGTGTGTCTGAGG + Intergenic
1092083340 12:5736136-5736158 TCTGCCTGTGGGTGTCCCTGTGG - Intronic
1093755452 12:22846865-22846887 TAAAACTGTGAGTGTTCCTGTGG - Intergenic
1096786904 12:54022032-54022054 TAAACCTCTGGGTGTCCCTGTGG + Intronic
1097647940 12:62259752-62259774 TAGTCGTCTGGGTGTGCCTGGGG + Intronic
1099463170 12:82948718-82948740 TAAATCTCTGTGTGCCCATGGGG + Intronic
1100152577 12:91758401-91758423 TAAAACTCTGGGTTTCCGTTGGG + Intergenic
1102926906 12:116833470-116833492 TCACCCTCTGGGTCTCGCTGTGG - Intronic
1106694844 13:32162416-32162438 TGAGGCTCTGAGTGTCCCTGTGG + Intronic
1117282801 14:54257146-54257168 TAAACCTCTGGGAGGCCATTTGG - Intergenic
1120516856 14:85481184-85481206 TCAACCTCTGGGAGGGCCTGTGG + Intergenic
1122132909 14:99615971-99615993 ACAACTTCTGGGTTTCCCTGGGG - Intergenic
1122140045 14:99657593-99657615 TTAACATCTGGGTCTTCCTGAGG - Intronic
1122742341 14:103879611-103879633 TAGACCTCTTGGTGACCTTGAGG + Intergenic
1124376751 15:29133413-29133435 GACACCAGTGGGTGTCCCTGTGG - Intronic
1128632840 15:69282852-69282874 GAAACGTCTGGGTGAACCTGGGG - Intergenic
1131312471 15:91303404-91303426 AAAACCTCTTGGTGTCCCCTGGG + Intergenic
1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG + Intergenic
1133118953 16:3594753-3594775 TCAACCTCTGAGTGACCCTAAGG + Intronic
1133988157 16:10684349-10684371 TGAGCCTCTGTGTGTCTCTGTGG + Intronic
1139877844 16:70160626-70160648 TAAAACTCCGGGTGTGCATGAGG - Exonic
1140992630 16:80228906-80228928 TATACCACTGGCTTTCCCTGGGG + Intergenic
1141034239 16:80614052-80614074 CAGACCTCTGGGTGTCCTTAAGG - Intronic
1141810744 16:86373755-86373777 CAGACCTCTGGGTCTCTCTGGGG + Intergenic
1142040161 16:87888321-87888343 CCAGCCTCTGGGTGTCCCTCAGG + Intronic
1142851106 17:2705143-2705165 TCAACATGTGGCTGTCCCTGAGG + Intronic
1142979299 17:3662543-3662565 GGCACCTCTGGGTGTCCCTACGG + Intergenic
1144673838 17:17148289-17148311 TAGACCTCTGGGGGTCCCTGAGG + Intronic
1146283561 17:31559896-31559918 CGAAGCTCTGGGTGTCCCTCAGG - Intergenic
1147308453 17:39579392-39579414 CAAAGCTCTGGCTGTCTCTGGGG - Intergenic
1147669423 17:42168185-42168207 CAATACTCTGGGTCTCCCTGAGG + Intronic
1149011693 17:51863656-51863678 CAAACCTGAGGGTGTCCGTGGGG - Intronic
1149692946 17:58593492-58593514 TAGACTTCTGTGTGTCTCTGAGG - Intronic
1150486715 17:65549179-65549201 TCATCATCTGGTTGTCCCTGTGG - Intronic
1156368201 18:36448764-36448786 TGGGCCTCTGGCTGTCCCTGGGG + Intronic
1159421359 18:68224701-68224723 TGAATCTTTGGGTGTCCCTGAGG - Intergenic
1160531990 18:79571191-79571213 TTTGCCTCTGGGTTTCCCTGAGG - Intergenic
1161706922 19:5826554-5826576 TGAGCCTCTGGGTGGCCCTGGGG - Intronic
1162568978 19:11459955-11459977 TAAAGACCTGAGTGTCCCTGGGG - Intronic
1162655302 19:12124389-12124411 TAAAGCTCAGGGTGTTCCTGGGG + Intronic
1163027912 19:14524078-14524100 TTACTCTCTGGGTGACCCTGGGG - Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1164501384 19:28823239-28823261 TCAACCTCTGGGTGATGCTGAGG + Intergenic
1165052971 19:33154700-33154722 TAATCCTCTGGGTATACCTCTGG + Intronic
925451433 2:3972975-3972997 TGCAGCTCTGGGCGTCCCTGTGG + Intergenic
926716197 2:15925785-15925807 TAATCCTCTTGGTGGTCCTGGGG - Intergenic
928729479 2:34214889-34214911 TAAACCCTTGGCTGGCCCTGAGG + Intergenic
929484390 2:42341134-42341156 TAAACCACTGTGTCCCCCTGTGG - Intronic
931176047 2:59856257-59856279 TACACCTTTGGGTTTCCCAGAGG - Intergenic
935535857 2:104293996-104294018 TAAACCTCTGGCTGGACCTTGGG - Intergenic
937772443 2:125735998-125736020 TTAACCTCTTTGTGCCCCTGGGG - Intergenic
937797521 2:126041507-126041529 TAAAGCTCTGTGTATCCCTGTGG - Intergenic
940197678 2:151113917-151113939 TACCCCTCTGGATGTCCCTATGG + Intergenic
941101932 2:161306576-161306598 CTAACCTCTGGGTGACCTTGAGG - Intergenic
941212124 2:162653017-162653039 TATAACTCTGGGTTTCCATGAGG - Intronic
941548128 2:166879410-166879432 TAAACCTCTGTTTGTGCCTTTGG - Intergenic
947717420 2:232348915-232348937 TACACCTCTGGGTGTGCCCAGGG + Intergenic
1169279845 20:4257708-4257730 TGCACCTCTGAGTGTCACTGAGG + Intergenic
1169690506 20:8325737-8325759 TCCACCTCTGGCTGTTCCTGAGG + Intronic
1169766220 20:9151003-9151025 TTAATTTCTGGGTTTCCCTGAGG + Intronic
1171006508 20:21471064-21471086 TTCATCTCTGGGTTTCCCTGTGG + Intergenic
1174156753 20:48520795-48520817 CAAACATCTGGGTGCACCTGGGG - Intergenic
1175413127 20:58784598-58784620 TGCACATCTGGGTGACCCTGGGG - Intergenic
1175736221 20:61389363-61389385 TAAACATCTGTTTGTCCCTGTGG + Intronic
1175879747 20:62250396-62250418 GTGACCTCTGGGTGTCCCTTTGG + Intronic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1178185695 21:30217572-30217594 CAAACTTCAGGGTGTCCCTTAGG + Intergenic
1178384067 21:32135161-32135183 TAATCCTCTGGGGGTGACTGTGG - Intergenic
1179731145 21:43367983-43368005 TACTCCTCTCTGTGTCCCTGGGG - Intergenic
1180676799 22:17592008-17592030 TAACCCTCTGGGGGTCCCCTGGG - Intergenic
1180698512 22:17769365-17769387 TCTCCCTCTGGGTATCCCTGAGG - Intronic
1184793314 22:46715498-46715520 TAAACATCTGCTTGACCCTGTGG - Intronic
949829433 3:8198107-8198129 TAATCCCCTGGGGGTCCCTGAGG - Intergenic
954630676 3:52046192-52046214 TTAACCTCTGGGTGCCCCGATGG - Intergenic
960568142 3:119156830-119156852 AAGGCCTGTGGGTGTCCCTGTGG + Intronic
961904715 3:130251101-130251123 TAAACCTCATGGTGGCCCCGAGG - Intergenic
962050690 3:131811657-131811679 TAGTCCTCTGAGTGTCCCAGCGG + Intronic
963636476 3:147803610-147803632 AGAACCTCTGGGTGTAACTGAGG + Intergenic
965350203 3:167602201-167602223 TAAACCAGTGGGTGTCCTTTGGG - Exonic
966620403 3:181956764-181956786 TAAACCTAATGGTGACCCTGAGG - Intergenic
967721424 3:192820197-192820219 TACACCTCTGTGTGTTTCTGGGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969648534 4:8448501-8448523 TGGACCTCTGGGGGACCCTGGGG + Intronic
971225730 4:24749880-24749902 TAATCCTCAGTGTGTCCATGAGG - Intergenic
972250743 4:37297954-37297976 TCAACCTAGGGGTGTTCCTGGGG - Intronic
974062284 4:57046120-57046142 TTGTCCTCTTGGTGTCCCTGTGG - Intronic
978585570 4:110272624-110272646 TACACCTGTGGCTGTACCTGAGG + Intergenic
982278039 4:153656857-153656879 TATTCCTCTGCGTGTCCCTCAGG + Intergenic
985315717 4:188657162-188657184 TGAACCCCTGGGTGTCGGTGGGG + Intergenic
985688212 5:1293403-1293425 TGAACTTCTTGGTGTTCCTGAGG + Exonic
990174314 5:53090409-53090431 TGCACCTCTGGGAATCCCTGAGG - Intronic
991042803 5:62193252-62193274 TACAGCTCAGGCTGTCCCTGGGG + Intergenic
992278867 5:75152302-75152324 TAAAGCTCTGTGTCTTCCTGGGG - Intronic
996751832 5:126896519-126896541 GCAACCCCTAGGTGTCCCTGTGG + Intronic
1003183170 6:3809206-3809228 TACACCTCAGGGTCTCCCTGTGG - Intergenic
1007764210 6:44151496-44151518 GAATCTTCTGGGTGTTCCTGGGG + Intronic
1007996786 6:46316055-46316077 GTCACCTCTGAGTGTCCCTGAGG + Intronic
1009452590 6:63818832-63818854 GAAACCTCCGTGTGGCCCTGTGG + Intronic
1013914701 6:115321454-115321476 CAAAAATCTGTGTGTCCCTGGGG + Intergenic
1017376988 6:153782302-153782324 TAAAGCTCTGTGTAACCCTGTGG - Intergenic
1019397029 7:826501-826523 TGCAGCTCTGGGTGTCCCTGTGG + Intronic
1021795098 7:24246571-24246593 ACACCCTCTGGGTGTCTCTGAGG - Intergenic
1023600953 7:41881208-41881230 TAAGCCACTGACTGTCCCTGGGG - Intergenic
1023851434 7:44152453-44152475 CCAGCCTGTGGGTGTCCCTGAGG - Intronic
1024054022 7:45648186-45648208 CACCCATCTGGGTGTCCCTGGGG - Intronic
1024734534 7:52290232-52290254 CACACCTCTGGGTTTCCCAGAGG - Intergenic
1029856759 7:103525156-103525178 TTAACCTCTGTGTGTCCTTCAGG + Intronic
1034179271 7:149125552-149125574 TGAACCTCGGGGTCTCTCTGGGG - Intronic
1035176868 7:157057619-157057641 GAAAGCTATCGGTGTCCCTGAGG - Intergenic
1039057913 8:33551218-33551240 CTCACCTCTGGGTCTCCCTGAGG - Intronic
1039796872 8:40923278-40923300 ATACCCTCTGGGTGACCCTGAGG + Intergenic
1040986262 8:53297153-53297175 TACACCTCTGGGTAGCCATGAGG - Intergenic
1048008142 8:130435825-130435847 AAAGCCTCTGGGTGTGACTGTGG + Intronic
1049952526 9:659349-659371 TAACCCGCTAGGTGACCCTGAGG - Intronic
1054933863 9:70666023-70666045 TAATCCTCTGGTTGCCTCTGTGG - Intronic
1057933020 9:99212375-99212397 TAGACCTCTGGGTGTACATGGGG + Intergenic
1058459446 9:105169495-105169517 TAGGACTTTGGGTGTCCCTGAGG - Intergenic
1061304164 9:129722965-129722987 CAAACATCTGGGTGTCCCCTTGG - Intergenic
1187034248 X:15521181-15521203 GGAACATCAGGGTGTCCCTGGGG - Intronic
1189101229 X:38192339-38192361 TCAAACTCTAGATGTCCCTGGGG + Intronic
1189119952 X:38383872-38383894 CAAACCTCTGGGTTGTCCTGGGG - Intronic
1192286966 X:69748407-69748429 TAAACCTTTGCCTATCCCTGTGG - Intronic
1193258707 X:79380081-79380103 CAAAACTCTGTGTGTGCCTGGGG - Intergenic
1197978041 X:132186148-132186170 TAATCTCCTGGCTGTCCCTGTGG - Intergenic