ID: 1096787467

View in Genome Browser
Species Human (GRCh38)
Location 12:54025695-54025717
Sequence TTATGACGTCCCTAAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096787467_1096787473 22 Left 1096787467 12:54025695-54025717 CCCTCTGTTTAGGGACGTCATAA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1096787473 12:54025740-54025762 AGGCTCACATTCTGCCTCTCAGG 0: 1
1: 0
2: 1
3: 49
4: 582
1096787467_1096787470 -5 Left 1096787467 12:54025695-54025717 CCCTCTGTTTAGGGACGTCATAA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1096787470 12:54025713-54025735 CATAAAACACTTAACTTTCTGGG 0: 1
1: 0
2: 0
3: 31
4: 290
1096787467_1096787471 -4 Left 1096787467 12:54025695-54025717 CCCTCTGTTTAGGGACGTCATAA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1096787471 12:54025714-54025736 ATAAAACACTTAACTTTCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 382
1096787467_1096787472 2 Left 1096787467 12:54025695-54025717 CCCTCTGTTTAGGGACGTCATAA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1096787472 12:54025720-54025742 CACTTAACTTTCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 221
1096787467_1096787469 -6 Left 1096787467 12:54025695-54025717 CCCTCTGTTTAGGGACGTCATAA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1096787469 12:54025712-54025734 TCATAAAACACTTAACTTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096787467 Original CRISPR TTATGACGTCCCTAAACAGA GGG (reversed) Intronic
904000270 1:27334987-27335009 TTATGAAGTCCATAGGCAGAGGG + Intronic
912718412 1:111999514-111999536 ATATGACTTCCTTAAACAGAAGG + Intergenic
912760895 1:112366356-112366378 CTATGAAGTCCCTACAGAGAAGG + Intergenic
918699187 1:187585962-187585984 TTATGACATCACTAAAGAGATGG - Intergenic
918758050 1:188361731-188361753 TTGTGACTACTCTAAACAGAAGG + Intergenic
920593009 1:207240461-207240483 TTTTAACCTCCCTAAAAAGAAGG - Intergenic
1064880348 10:20044985-20045007 TTATGAGGTTCTGAAACAGAGGG + Intronic
1069794448 10:71043206-71043228 TTATCCCATCCCTAAAGAGAGGG - Intergenic
1074254202 10:111784078-111784100 TGATAACCTCCCCAAACAGATGG + Intergenic
1079676857 11:23239226-23239248 TTATGAAGTCTCTCAAAAGAAGG - Intergenic
1085293263 11:75415358-75415380 TTATAATGTCTCCAAACAGAGGG - Intronic
1085877380 11:80425209-80425231 TTATGCTGTCCCCTAACAGAAGG + Intergenic
1091352846 11:134911503-134911525 TAATTATTTCCCTAAACAGATGG + Intergenic
1091445082 12:540429-540451 CTATGACGTCCCCAGGCAGAGGG - Intronic
1094013694 12:25838206-25838228 TTAAGACGTCCTCACACAGAAGG + Intergenic
1094128610 12:27050621-27050643 TTATGACATCCCATAGCAGAAGG - Intronic
1095356111 12:41277498-41277520 ATATGATGTCTATAAACAGATGG + Intronic
1096787467 12:54025695-54025717 TTATGACGTCCCTAAACAGAGGG - Intronic
1098225617 12:68319523-68319545 TTATGAGGTTCCTAAATATAAGG - Intronic
1118055884 14:62079407-62079429 TTACAACATCCCTACACAGAAGG + Intronic
1125102845 15:35934818-35934840 GTATAACCTCCCAAAACAGAGGG + Intergenic
1126010823 15:44300667-44300689 TTATGACCTCATTAAACAGGAGG + Intronic
1128278375 15:66373622-66373644 TTATGACTTCCTTACACTGATGG - Intronic
1133474207 16:6104094-6104116 CTATGATGTCCCTAATTAGAAGG - Intronic
1136230133 16:28880862-28880884 TAATGAGGCCCCAAAACAGATGG - Intronic
1153749700 18:8216132-8216154 TTATGACTTCCATGAAAAGAAGG - Intronic
1157687838 18:49657135-49657157 TTATGACTTGACTAAACAGGAGG - Intergenic
1158542661 18:58370825-58370847 TTATGATGTCAGGAAACAGAGGG - Intronic
1162156522 19:8681790-8681812 TTATGATCTCCATTAACAGATGG + Intergenic
926999509 2:18778299-18778321 TTATGAAGTGCCTGTACAGATGG - Intergenic
933859615 2:86452637-86452659 GTATGAAGTCACAAAACAGAAGG - Intronic
935434593 2:103015500-103015522 TTTTGACATCCCTAAGCGGATGG - Intergenic
937496326 2:122424043-122424065 TTATCACGGCCCTAAACAGCTGG - Intergenic
1179453198 21:41479665-41479687 CTGTGACATCCCTAAACAGCAGG - Intronic
949343638 3:3055690-3055712 TTATTACCTCGCTTAACAGATGG - Intronic
967092501 3:186147166-186147188 TTGTGTTGTCCCTAAACTGATGG - Intronic
970704788 4:18787296-18787318 TTATGACATCGTTAAAGAGATGG + Intergenic
972848675 4:43021374-43021396 TTATAAGGCCCCTAAAAAGAGGG - Intronic
972891182 4:43557960-43557982 TTAGCACATCCCTACACAGATGG + Intergenic
977361705 4:96013818-96013840 TTCTCACGTCCCTAAAATGACGG - Intergenic
991415865 5:66392374-66392396 TTTTGTTGTTCCTAAACAGACGG + Intergenic
998322298 5:141243993-141244015 TTATGATGACCCTAAAGATAAGG - Intergenic
1005333563 6:24771632-24771654 TTAGGATGTCCTTCAACAGAGGG - Intergenic
1025274405 7:57564327-57564349 TAAGTACGTCCCTAAACAGGTGG - Intergenic
1027563581 7:79762844-79762866 TAATGACATTTCTAAACAGAGGG - Intergenic
1028611749 7:92719572-92719594 TTATTAAGTCACTAAAAAGATGG + Intronic
1030898040 7:115085838-115085860 TCATGAGGGCCCTCAACAGATGG + Intergenic
1036413033 8:8520099-8520121 ATGTGGTGTCCCTAAACAGATGG - Intergenic
1039821404 8:41138517-41138539 CTGTGACGTCCCAAAACAGAGGG + Intergenic
1042097994 8:65239983-65240005 TTATGAAGAACCTAAATAGAAGG + Intergenic
1052045490 9:23789199-23789221 TTATTCAGTCCCTATACAGAGGG + Intronic
1053533207 9:38901740-38901762 TAATGAAGGCCCTGAACAGAGGG - Intergenic
1054205433 9:62126169-62126191 TAATGAAGGCCCTGAACAGAGGG - Intergenic
1054632928 9:67462201-67462223 TAATGAAGGCCCTGAACAGAGGG + Intergenic
1055043223 9:71898239-71898261 ATATGACTTCCCAAAACGGAGGG + Intronic
1056109505 9:83380931-83380953 CCATGACGACCCTAAAAAGATGG + Intronic
1057151011 9:92796144-92796166 TAATGAAGGCCCTGAACAGAGGG + Intergenic
1058360856 9:104144388-104144410 TCATGAAGCCCCTACACAGAGGG + Intergenic
1062730955 9:138108437-138108459 TTATTTCTTCCCTAAACAGTTGG - Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1188939054 X:36215106-36215128 TTATGACGTCACTAGGCAGTAGG + Intergenic
1193820418 X:86156400-86156422 ATATGACGTTCCTTAACAAAAGG + Intronic
1194790611 X:98144844-98144866 TTATGAAGTCTCTCATCAGATGG + Intergenic