ID: 1096788132

View in Genome Browser
Species Human (GRCh38)
Location 12:54029446-54029468
Sequence CACAGGTCCCACCTTATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096788127_1096788132 2 Left 1096788127 12:54029421-54029443 CCACCACACACCTTTCTTTGGGA 0: 1
1: 0
2: 2
3: 19
4: 263
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788114_1096788132 15 Left 1096788114 12:54029408-54029430 CCCGCCCCCCCCCCCACCACACA 0: 1
1: 9
2: 113
3: 1526
4: 6412
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788109_1096788132 22 Left 1096788109 12:54029401-54029423 CCGCCCCCCCGCCCCCCCCCCCA 0: 5
1: 49
2: 1041
3: 11601
4: 26855
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788119_1096788132 8 Left 1096788119 12:54029415-54029437 CCCCCCCCACCACACACCTTTCT 0: 1
1: 1
2: 8
3: 136
4: 1018
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788123_1096788132 4 Left 1096788123 12:54029419-54029441 CCCCACCACACACCTTTCTTTGG 0: 1
1: 0
2: 3
3: 31
4: 316
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788117_1096788132 10 Left 1096788117 12:54029413-54029435 CCCCCCCCCCACCACACACCTTT 0: 1
1: 0
2: 18
3: 190
4: 1720
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788128_1096788132 -1 Left 1096788128 12:54029424-54029446 CCACACACCTTTCTTTGGGACAC 0: 1
1: 1
2: 0
3: 16
4: 160
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788130_1096788132 -8 Left 1096788130 12:54029431-54029453 CCTTTCTTTGGGACACACAGGTC 0: 1
1: 0
2: 2
3: 18
4: 169
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788122_1096788132 5 Left 1096788122 12:54029418-54029440 CCCCCACCACACACCTTTCTTTG 0: 1
1: 0
2: 4
3: 55
4: 485
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788120_1096788132 7 Left 1096788120 12:54029416-54029438 CCCCCCCACCACACACCTTTCTT 0: 1
1: 0
2: 4
3: 85
4: 781
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788108_1096788132 23 Left 1096788108 12:54029400-54029422 CCCGCCCCCCCGCCCCCCCCCCC 0: 2
1: 61
2: 804
3: 3048
4: 15990
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788121_1096788132 6 Left 1096788121 12:54029417-54029439 CCCCCCACCACACACCTTTCTTT 0: 1
1: 0
2: 5
3: 85
4: 732
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788125_1096788132 3 Left 1096788125 12:54029420-54029442 CCCACCACACACCTTTCTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788111_1096788132 18 Left 1096788111 12:54029405-54029427 CCCCCCGCCCCCCCCCCCACCAC 0: 1
1: 21
2: 1360
3: 10072
4: 24131
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788112_1096788132 17 Left 1096788112 12:54029406-54029428 CCCCCGCCCCCCCCCCCACCACA 0: 1
1: 10
2: 1325
3: 10093
4: 24446
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788110_1096788132 19 Left 1096788110 12:54029404-54029426 CCCCCCCGCCCCCCCCCCCACCA 0: 1
1: 20
2: 262
3: 2290
4: 10334
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788115_1096788132 14 Left 1096788115 12:54029409-54029431 CCGCCCCCCCCCCCACCACACAC 0: 1
1: 40
2: 360
3: 3262
4: 17671
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788116_1096788132 11 Left 1096788116 12:54029412-54029434 CCCCCCCCCCCACCACACACCTT 0: 1
1: 0
2: 28
3: 232
4: 2646
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788107_1096788132 24 Left 1096788107 12:54029399-54029421 CCCCGCCCCCCCGCCCCCCCCCC 0: 1
1: 50
2: 756
3: 2755
4: 13876
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788118_1096788132 9 Left 1096788118 12:54029414-54029436 CCCCCCCCCACCACACACCTTTC 0: 1
1: 0
2: 19
3: 314
4: 6535
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1096788113_1096788132 16 Left 1096788113 12:54029407-54029429 CCCCGCCCCCCCCCCCACCACAC 0: 1
1: 6
2: 185
3: 9609
4: 24700
Right 1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096788132 Original CRISPR CACAGGTCCCACCTTATAGG AGG Intronic
900336340 1:2165860-2165882 GACAGGGCCCACCTCCTAGGAGG + Intronic
901613620 1:10519227-10519249 CACAGGGCACGCCTAATAGGAGG - Intronic
905095136 1:35463789-35463811 CACAATTCCCACCTCATGGGAGG + Intronic
906164948 1:43679222-43679244 CACAGGGCCCAGCTTCTAGAAGG - Intronic
907336790 1:53704912-53704934 CACAGGCACCACCTCATGGGAGG + Intronic
912895134 1:113578318-113578340 AACAGGCCCCACCTCTTAGGAGG + Intronic
924728322 1:246690276-246690298 CACGGGTCCCACCTCACACGTGG + Intergenic
1062784078 10:246662-246684 CACAGGTCGCACTTTATGGCAGG + Intronic
1063372833 10:5532896-5532918 CACTGGTCCCATCTTCAAGGAGG - Intergenic
1067853538 10:49770189-49770211 CACAGTTACCACCTCTTAGGAGG + Intergenic
1073558853 10:104480274-104480296 CACAGGTCCCACCCTTAAGCTGG - Intergenic
1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG + Intronic
1079109742 11:17598587-17598609 TAGCGGTCCCACCTTAGAGGAGG + Intronic
1080415441 11:32065774-32065796 CTCAGGTCCCACCTCCTATGGGG + Intronic
1081824858 11:46039466-46039488 TACAGGGCCCACCTTGAAGGAGG + Intronic
1083295528 11:61713473-61713495 CCCAGTCCCCAACTTATAGGTGG + Intronic
1083607449 11:63987143-63987165 CCCAGGGCCCAACTCATAGGCGG - Intronic
1084072149 11:66743773-66743795 CCCAGGTCCCACCTTTGCGGGGG + Intergenic
1091332070 11:134737699-134737721 CCCAGGTCCCACCTTGGAGGAGG + Intergenic
1093414524 12:18905029-18905051 CACAGGTGCCACCTAATTAGTGG - Intergenic
1093432732 12:19102581-19102603 CACAGGGCCCATCTCCTAGGTGG - Intergenic
1093435599 12:19130645-19130667 CACAAGTCCCACCTAGGAGGAGG - Intronic
1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG + Intronic
1099396687 12:82148387-82148409 CACAGGTTCTAACTTATAAGTGG - Intergenic
1100952768 12:99870168-99870190 CACAGGTTCTCACTTATAGGTGG - Intronic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1103482446 12:121259797-121259819 AACAGTGCCCACCATATAGGAGG + Intronic
1109129769 13:58568613-58568635 CTCATATCCTACCTTATAGGAGG - Intergenic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1113291457 13:108911399-108911421 CACAGGTACTACCTGGTAGGAGG - Intronic
1119261526 14:73240788-73240810 CACAGGCCCCACCTTTGGGGAGG + Intronic
1119262636 14:73246470-73246492 CACAGGACCCACCTTTGGGGAGG + Intronic
1121773077 14:96569194-96569216 CACATTTCCCACCTTACTGGTGG - Intergenic
1122356340 14:101125218-101125240 CAGGGGTCCCCCCTTATCGGGGG + Intergenic
1128183264 15:65623566-65623588 CACAGGTCTCACCTTATCAAAGG - Intronic
1131332292 15:91513177-91513199 CACAGTTCCCACCTGATCAGTGG + Intergenic
1134349678 16:13425117-13425139 CACATGTTCCCGCTTATAGGTGG + Intergenic
1134760677 16:16711746-16711768 CACTGTTACCACCTTTTAGGAGG - Intergenic
1134985382 16:18647427-18647449 CACTGTTACCACCTTTTAGGAGG + Intergenic
1137902729 16:52286770-52286792 CACATGTCCCCACTTATAAGTGG + Intergenic
1138431456 16:56971864-56971886 CCCAGGTCCCACTTTACAGAGGG + Intronic
1138694368 16:58797972-58797994 CAAAGGTCCCACCTCTTAAGGGG + Intergenic
1139391700 16:66609579-66609601 CCCAGGTCCCACCCTAAATGAGG - Intronic
1142146731 16:88495917-88495939 CCCAGCTCCCACCTCACAGGCGG - Intronic
1143109012 17:4543235-4543257 CCCAAGTCCCACTTTATAAGTGG + Intronic
1144864683 17:18327542-18327564 CTGTGGTCCCACCTTGTAGGTGG - Intergenic
1148169632 17:45508227-45508249 CACAGGTCCCATCTAAAATGAGG - Intergenic
1148336954 17:46848377-46848399 CACAGGTCCCAGCACATAGTAGG - Intronic
1149037259 17:52148853-52148875 CCCAGTGCCCACCTCATAGGAGG + Intronic
1152932192 17:83115668-83115690 CACAGGGGCCACCATATGGGAGG + Intergenic
1153116059 18:1657919-1657941 TACAGGTTCCTCCTTATAGGAGG + Intergenic
1153330090 18:3864786-3864808 TACATGTGCCACCTTAGAGGTGG - Intronic
1158170313 18:54591100-54591122 AACAGGATCCACCTTAGAGGAGG - Intronic
1160851613 19:1195510-1195532 CAGAGGTCCCAAGTTATAGGTGG - Intronic
1160852037 19:1197324-1197346 CAGAGGTCCCAAGTTATAGGTGG - Intronic
1165662778 19:37596735-37596757 CACTGGTGCCACCTTAAAGAGGG - Intronic
1166145166 19:40829264-40829286 CACAGGTTCTCACTTATAGGTGG - Intronic
1167256160 19:48430485-48430507 CATAGCTCCCAGCTGATAGGGGG + Intronic
926138280 2:10352743-10352765 CAAAGGTCCCTCCTGATGGGGGG - Intronic
926942375 2:18151970-18151992 CACAGGTCCCTGCTTATCTGAGG + Intronic
927256279 2:21043631-21043653 CACAGGTTTCACCTTTCAGGAGG + Intronic
930898924 2:56480527-56480549 CACAGTTCCTGCTTTATAGGGGG - Intergenic
930903553 2:56537614-56537636 TACAGGTCCCAAAGTATAGGTGG + Intergenic
931301592 2:60984468-60984490 AACTGGTACCACCTTTTAGGAGG + Intronic
933636836 2:84717552-84717574 CACAGTGCCCACCTTATGGGGGG + Intronic
934872834 2:97883038-97883060 CACAGGTGACACCTTCTAGCTGG + Intronic
947637147 2:231685945-231685967 CACAGGGCCCACCTCACTGGGGG + Intergenic
1170544856 20:17427184-17427206 CACAGGGCCCATCTCATAGTAGG + Intronic
1172528670 20:35616402-35616424 TACAGGACCCACCTTGTAGGAGG - Intronic
1177356704 21:20018169-20018191 TACAGATCTCACCTAATAGGAGG + Intergenic
1180715348 22:17868205-17868227 CACAGTACCCACCTCATAGGTGG + Intronic
1183192825 22:36332596-36332618 CCCAAGTCCCCACTTATAGGAGG + Intronic
1183357862 22:37369065-37369087 GACAGGTCCTAGCTTATAAGGGG - Exonic
949617115 3:5766127-5766149 CACAGGTTCTCCCTTATAAGTGG + Intergenic
953611429 3:44450604-44450626 CACAGCTCCCAGCTTTGAGGTGG + Intronic
954909780 3:54094522-54094544 CACAGTTCCCACCATTTAGGAGG + Intergenic
958871983 3:99570463-99570485 CACAGGTCTCACCTCATTTGAGG - Intergenic
961109507 3:124271947-124271969 CACAGGTTCCGACTTATAAGTGG + Intronic
964429967 3:156595028-156595050 GACTGATGCCACCTTATAGGTGG + Intergenic
970981901 4:22108526-22108548 TACAGGTCCCATCTGAAAGGTGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
975389975 4:73804556-73804578 CACAGGACCTACCTTACAAGAGG + Intergenic
977870853 4:102088994-102089016 CACAGTTCCCACGTCATAGGAGG + Intergenic
978904859 4:113993874-113993896 CCCATGTCCCACCCTATAGAGGG - Intergenic
985630669 5:1012421-1012443 GGCAGGTCCCAGCTTACAGGAGG + Intronic
987779821 5:22419379-22419401 CACATGTTCCCACTTATAGGTGG - Intronic
997073797 5:130647797-130647819 CACATGTTCTACCTTATAAGTGG - Intergenic
997731800 5:136186487-136186509 CACAGGTCCAACTTTATGGTAGG + Intronic
1003616223 6:7657592-7657614 CAAAGGTCCTAGCTTAAAGGAGG - Intergenic
1007865006 6:44958571-44958593 GCCAGGTCCCCCCTTATATGGGG - Intronic
1008090234 6:47286236-47286258 CACAGGACACACCGTATGGGGGG + Exonic
1011878802 6:91997000-91997022 CACAGGTCCTCACTTATAGGTGG + Intergenic
1016678721 6:146803422-146803444 CACAGCCCCCACCTTCCAGGGGG + Intronic
1020906109 7:14066400-14066422 ATCAGGTCCCACCTTATAGCTGG - Intergenic
1028775927 7:94676049-94676071 CACATGTTCCCCCTTATAAGTGG - Intergenic
1035140186 7:156751920-156751942 TAGAGGTCGCAGCTTATAGGTGG + Intronic
1037002548 8:13737539-13737561 CACTAGTACCACCTTATTGGTGG - Intergenic
1037707393 8:21326642-21326664 CACAAGTCCCGCTTTAAAGGGGG + Intergenic
1041357008 8:57012050-57012072 CACTGGGCCCACCTTAAGGGTGG - Intergenic
1046327116 8:112663402-112663424 CACATGTCCTCACTTATAGGTGG + Intronic
1047306323 8:123655761-123655783 CACAGGGCCTGGCTTATAGGGGG + Intergenic
1047827242 8:128590500-128590522 CACATGTTCCAACTTATAAGCGG + Intergenic
1186628186 X:11317712-11317734 CACCGGCCCCACCTTAGAGCAGG + Intronic
1187439937 X:19309331-19309353 CACAGGGCCCCACATATAGGAGG - Intergenic
1188722008 X:33533576-33533598 CACATGTTCCTACTTATAGGTGG + Intergenic
1199608761 X:149596375-149596397 CACAGGTCCCAGGGTATACGGGG - Intergenic
1199630361 X:149772985-149773007 CACAGGTCCCAGGGTATACGGGG + Intergenic