ID: 1096788632

View in Genome Browser
Species Human (GRCh38)
Location 12:54031784-54031806
Sequence ACTTGGGGCTACGGGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096788618_1096788632 26 Left 1096788618 12:54031735-54031757 CCTGGCGGGGCGGAGATTTCCTG 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1096788632 12:54031784-54031806 ACTTGGGGCTACGGGGGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 200
1096788624_1096788632 7 Left 1096788624 12:54031754-54031776 CCTGGGAAGAAGCAGGCAGGGAA 0: 1
1: 0
2: 7
3: 82
4: 554
Right 1096788632 12:54031784-54031806 ACTTGGGGCTACGGGGGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096788632 Original CRISPR ACTTGGGGCTACGGGGGAAG AGG Intronic
900512688 1:3068041-3068063 TTTGGGGGCTACAGGGGAAGAGG + Intergenic
902622142 1:17656715-17656737 ACTGGGGGGAATGGGGGAAGGGG + Intronic
905145834 1:35886174-35886196 GCTTGGGCCTAGGGGGAAAGGGG - Intronic
905824359 1:41017511-41017533 ACTGGGGGCCACAGGAGAAGAGG - Intronic
906046208 1:42832852-42832874 ACAGGAGGCTATGGGGGAAGAGG + Intronic
906107880 1:43305571-43305593 ATTTGGGGCTAAGAGGGAAGGGG - Intronic
906717580 1:47981591-47981613 ATATGGGGCTAGTGGGGAAGGGG - Intronic
907297495 1:53464712-53464734 AACTGGGGCTGCGGTGGAAGCGG - Exonic
907431660 1:54415622-54415644 ACATGGGGCTCAGGAGGAAGTGG + Intergenic
907923131 1:58931557-58931579 ACTTGGGGACACAGGGGATGTGG - Intergenic
908483198 1:64564385-64564407 GCTTGGGGCTTCTGGGGAAGGGG - Intronic
913331864 1:117674497-117674519 ACTTGGGGGTAAGGTGGATGGGG - Intergenic
913965993 1:143377948-143377970 ACTAGGGACTACTGGGGGAGAGG - Intergenic
914060367 1:144203556-144203578 ACTAGGGACTACTGGGGGAGAGG - Intergenic
914118783 1:144762813-144762835 ACTAGGGACTACTGGGGGAGAGG + Intergenic
917470911 1:175324986-175325008 ACTTGAGGCCACATGGGAAGAGG + Intronic
918121755 1:181546584-181546606 GTTTGGGGCTAGGGTGGAAGGGG + Intronic
919788904 1:201277446-201277468 AATGGGGGCTACTGGGGCAGGGG - Intergenic
1067207190 10:44228907-44228929 ACTGGGGCCTGCGGGGGATGAGG + Intergenic
1068829713 10:61479605-61479627 GATTGGGGATAAGGGGGAAGTGG - Intergenic
1068867653 10:61911735-61911757 TCTTGGGGCTTGGGGGGCAGCGG + Intronic
1069788430 10:71004495-71004517 ATCTGGGGCTGCTGGGGAAGGGG - Intergenic
1071231306 10:83589334-83589356 AATTGGTGCTATGGGTGAAGGGG - Intergenic
1071679173 10:87687192-87687214 ACTTGGGGCTGTGGGGATAGTGG - Intronic
1074288823 10:112122923-112122945 ACTAGGGGCTGGGAGGGAAGTGG + Intergenic
1075357722 10:121797491-121797513 GCTAGGGGCTAGGGGGCAAGGGG - Intronic
1076419937 10:130324159-130324181 ACTCTGAGCTACTGGGGAAGGGG + Intergenic
1076568699 10:131416927-131416949 ACTTGGAGCTACTGTGGAAAGGG - Intergenic
1077701223 11:4444007-4444029 ACTTGGGGCAATGGTGGAAGGGG + Intergenic
1078143714 11:8709261-8709283 ACTTGGGGCTTTAGGGGAGGCGG - Intronic
1078840506 11:15072847-15072869 ATTTGGGGATATAGGGGAAGAGG + Intronic
1079565201 11:21874252-21874274 ACTTGGGGTTTTGGCGGAAGTGG - Intergenic
1080672581 11:34394933-34394955 ACTTGGGGCTATTGGGGTTGGGG - Intergenic
1080884236 11:36350697-36350719 ACTTGGGGACTCGGGGGAAAGGG - Intronic
1081094051 11:38909609-38909631 ACTGGGGCCTATTGGGGAAGGGG + Intergenic
1081796401 11:45823478-45823500 ACTTGAGTGTAAGGGGGAAGGGG - Intergenic
1083778758 11:64907330-64907352 ACTTGGGGCCTCAGGGGCAGCGG + Exonic
1084116736 11:67046746-67046768 TCTTGGGACCATGGGGGAAGTGG + Intronic
1085765299 11:79276896-79276918 AGTTGGGGGGATGGGGGAAGGGG - Intronic
1087262385 11:96025384-96025406 ACTGGGGACTACTGGGGGAGGGG + Intronic
1088900410 11:114111897-114111919 ACTTGGGGTAAAAGGGGAAGAGG - Intronic
1089019626 11:115199544-115199566 ATTTTTGGCTACAGGGGAAGTGG + Intronic
1090352923 11:126119001-126119023 TCCTGGGGCTACACGGGAAGCGG + Intergenic
1093408722 12:18839355-18839377 ACTTGGGGGGAAGGTGGAAGGGG - Intergenic
1094504359 12:31048937-31048959 AGTTGTGGCTACGGAGAAAGAGG + Intergenic
1095783332 12:46084697-46084719 ACTTGGGGGTGGGGGGGATGTGG - Intergenic
1096180827 12:49549547-49549569 GCTTGGGGATACGGTGGATGCGG - Exonic
1096788632 12:54031784-54031806 ACTTGGGGCTACGGGGGAAGAGG + Intronic
1097066253 12:56322835-56322857 AGTTGGGGGTATGGGGGATGGGG + Intronic
1099827673 12:87799129-87799151 ACTTGAGGGTACAGGGTAAGAGG - Intergenic
1100085132 12:90901471-90901493 CCTGGGGGCTAAGGGGGAAAGGG - Intergenic
1101353823 12:103957649-103957671 ACCTGGTGCTACTGGGAAAGGGG + Intronic
1102068551 12:109999184-109999206 ACATGGGGCTACTGGAGCAGGGG + Intronic
1102672444 12:114631518-114631540 GCATGGGGCTAAGGGGGAAGGGG + Intergenic
1103911754 12:124355840-124355862 ACTGGGGGCTACAGTGGAAATGG - Intronic
1106014597 13:25856753-25856775 ACCTGGGGCTGGGGAGGAAGGGG - Intronic
1107683359 13:42872182-42872204 ACTTGCTGCTAAGGGTGAAGGGG + Intergenic
1107998545 13:45885832-45885854 CCTTGGGGCTAGAGGAGAAGAGG + Intergenic
1110200555 13:72845134-72845156 ACTTGGGGGTGGGGGGCAAGGGG - Intronic
1111396783 13:87675999-87676021 ACTTGGACCTCCGGGGGAACCGG + Exonic
1111492581 13:89001789-89001811 ACTTGGGGAAAAGGTGGAAGGGG - Intergenic
1111968584 13:94886351-94886373 ACATGGGGGTAGGGGGGAGGGGG - Intergenic
1112506848 13:99980786-99980808 ACTAGGGGGTGCGGGGGGAGGGG + Intergenic
1114639715 14:24211396-24211418 ACATGTGGGTACGGGGGGAGGGG - Exonic
1118305649 14:64652919-64652941 TCTTGGGGCTTCAGGGTAAGTGG - Intergenic
1119915160 14:78392489-78392511 ACTGGGGGCTACAGGGCCAGAGG + Intronic
1122066163 14:99175635-99175657 ACTTGGGGCTGGGCTGGAAGGGG + Exonic
1123631196 15:22260833-22260855 CCTTGGGGCTGGGGGGGAGGGGG - Intergenic
1123668516 15:22629469-22629491 ACTTGCAGCTACTTGGGAAGCGG + Intergenic
1123733320 15:23163834-23163856 GCTGGGGGCTCCGGGGGCAGAGG - Intergenic
1123751454 15:23361226-23361248 GCTGGGGGCTCCGGGGGCAGAGG - Exonic
1124283823 15:28385130-28385152 GCTGGGGGCTCCGGGGGCAGAGG - Exonic
1124298874 15:28526484-28526506 GCTGGGGGCTCCGGGGGCAGAGG + Exonic
1124524493 15:30435931-30435953 ACTTGCAGCTACTTGGGAAGCGG + Intergenic
1124774157 15:32571779-32571801 ACTTGCAGCTACTTGGGAAGCGG - Intergenic
1124890296 15:33726229-33726251 ACTTGTGGCCACAGGGAAAGAGG - Intronic
1127257339 15:57303402-57303424 ACTTCTGGCTCCGGGGTAAGCGG - Intergenic
1127884884 15:63189939-63189961 ACGTGAGGCTAAGGGCGAAGGGG + Intronic
1128750847 15:70147953-70147975 ACTGGGGGCTGCCGGGGGAGGGG + Intergenic
1129141270 15:73600027-73600049 ACTTGGGGTTACAGTGGAATTGG - Intronic
1129181709 15:73881986-73882008 ACTTGGGGCCCAGGGGTAAGAGG - Intronic
1129203880 15:74023796-74023818 ACCTGGGGTTACGGTAGAAGGGG + Intronic
1132675891 16:1121144-1121166 GCTCGGGGCTCCGGGGAAAGGGG - Intergenic
1133411969 16:5576561-5576583 ATTAGGGTCTACGGGGGAAAGGG - Intergenic
1134857331 16:17531288-17531310 ACTTGGGGGTACATGGGGAGGGG - Intergenic
1136233663 16:28902316-28902338 CCTTGGGGCTCCGGGGGGGGCGG - Exonic
1136636599 16:31528254-31528276 ACTGGGGGGTGCCGGGGAAGTGG + Intronic
1138806887 16:60100557-60100579 ACCTGGGGATAGGGGAGAAGTGG + Intergenic
1139477185 16:67208612-67208634 ACTGGGGGCTTCGGGGGCTGGGG - Intronic
1140930850 16:79626462-79626484 ACTTGGGGCCACAAGAGAAGAGG + Intergenic
1142743832 17:1945170-1945192 ACTTGGGGCACCTGAGGAAGAGG - Intronic
1143114872 17:4576718-4576740 GCTGGGGGCTATAGGGGAAGCGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG + Intronic
1147040949 17:37718593-37718615 ATTTGGGGCTTAGGAGGAAGAGG - Intronic
1147607816 17:41784395-41784417 ACTGGGGGATGCGGGGGAGGAGG - Intronic
1148167691 17:45494817-45494839 GCTTGGGGCTGAGGGCGAAGGGG - Intergenic
1150216916 17:63476440-63476462 GCTTGGGGCTGCGAGGGAGGGGG - Intergenic
1154402261 18:14051349-14051371 ACTTGGAGCTAAGGGGAAGGGGG + Intergenic
1155053637 18:22168010-22168032 ACTTGTGGCTCCTGGGGGAGCGG - Intergenic
1156873973 18:41983402-41983424 CTTTGGGGCTTCAGGGGAAGAGG - Intronic
1158537163 18:58318804-58318826 ACTGAGGGCTCCAGGGGAAGGGG - Intronic
1160943974 19:1632723-1632745 ACTTGGGGCTGATGGGGAGGAGG - Intronic
1161209860 19:3060892-3060914 ACTTGGGGGTATTGGGGAGGAGG + Intronic
1162366915 19:10255308-10255330 TCTTGGGGTTGTGGGGGAAGGGG - Intronic
1163444266 19:17337663-17337685 AGGTGGGGCTACAGGGGAAGGGG + Exonic
1166318738 19:42003486-42003508 AGTTGGGGCTGTGTGGGAAGGGG + Intronic
1202699771 1_KI270712v1_random:155441-155463 ACTAGGGACTACTGGGGGAGAGG - Intergenic
926297300 2:11578097-11578119 ACTTGTGGCTACGTGCCAAGGGG - Intronic
927044244 2:19261421-19261443 GCTTGCGGCTACGGGGAAGGAGG + Intergenic
927704686 2:25289844-25289866 ACTTTGGGCAAAGGGGGAAGAGG - Intronic
927868598 2:26609035-26609057 ATTTGGGGCTCTGGGAGAAGTGG - Intronic
930872976 2:56185531-56185553 ACCTGGGGTTAAGTGGGAAGGGG - Intronic
932246553 2:70201817-70201839 ACTTGGGGGTCCGGAGGCAGGGG - Intronic
934664811 2:96163044-96163066 AGTTGGGGCTGCTGGGGAAGTGG + Intergenic
935717423 2:105951701-105951723 ACTTGGGGATACGTGGGCAGGGG - Intergenic
938540389 2:132280127-132280149 AGATGGGGCTGCGGGGGAGGTGG + Intergenic
938618085 2:133020519-133020541 ACTTTGGGGTTCAGGGGAAGTGG + Intronic
940045150 2:149401868-149401890 CTTTGGGGATTCGGGGGAAGGGG - Intronic
940760337 2:157731802-157731824 AATTGTTGCTACTGGGGAAGGGG + Intergenic
946325457 2:218982523-218982545 ACTTGGGGGTTGGGGGGAAGGGG + Intronic
1169748828 20:8970674-8970696 ACCTGTGGCTATGGGGGAGGGGG - Intergenic
1173104156 20:40116436-40116458 GCTTGGGGCTGCGGGAGAGGAGG + Intergenic
1173172921 20:40741996-40742018 CCTTAGGGCTACGGGAGAAGTGG - Intergenic
1173749053 20:45462026-45462048 ACTTGGGGGGAAGGGGCAAGGGG - Intergenic
1175194928 20:57236547-57236569 ATTTGGGGCTACCTGGGAGGGGG + Intronic
1176179640 20:63743232-63743254 CCTTGGGGCTAAGGGGACAGCGG - Exonic
1177550417 21:22613882-22613904 ACTGGGGCCTACTGGAGAAGTGG + Intergenic
1178280770 21:31280812-31280834 ACTTGGGGGTGGGGGGGCAGGGG + Intronic
1181456863 22:23064739-23064761 ACCTGGGGCTCTGTGGGAAGGGG + Intronic
1183377347 22:37472893-37472915 AGTAGGGGCTCCGGGTGAAGAGG - Intronic
952838834 3:37627445-37627467 CCTCGGGGCTGCGGGGGGAGAGG - Intronic
955440338 3:58948031-58948053 ACTTGGGTCCATGGGTGAAGTGG + Intronic
956597711 3:70986341-70986363 TCTTGGGGCTTCTTGGGAAGAGG - Intronic
958450473 3:94266812-94266834 ACCTGAGGCTAGGTGGGAAGGGG - Intergenic
961821012 3:129575645-129575667 AGTTGGGGCTGCTGGGGATGGGG + Intronic
962389940 3:134962841-134962863 ATTTGGGGCTGCTGGGGAAGGGG - Intronic
964208237 3:154198719-154198741 ACTTGGGGAGAAGGGGGAAAAGG + Intronic
964692471 3:159466236-159466258 ACCTGGGACTACAGGGGAGGTGG + Intronic
968384143 4:121774-121796 ACTTGGAGAAATGGGGGAAGGGG - Intergenic
969594481 4:8141191-8141213 ACTTAGGGCTCCGGGGGGTGGGG - Intronic
972936654 4:44144644-44144666 ACTTGGGGACTCGGGGGAAAGGG + Intergenic
973063122 4:45754781-45754803 ACTTGTGGTTTCAGGGGAAGAGG - Intergenic
975699690 4:77051546-77051568 ACTTGGGACTTGGGTGGAAGTGG - Intronic
976316765 4:83666909-83666931 AGATGGGGCTAGGTGGGAAGGGG + Intergenic
977306273 4:95327657-95327679 CACTGGGGCTACAGGGGAAGAGG - Intronic
977445664 4:97128644-97128666 ACCTGGGGCTGTTGGGGAAGGGG + Intergenic
977646330 4:99416854-99416876 ATTGGGGGCTAGGGTGGAAGTGG - Intronic
978051423 4:104204852-104204874 TCTTGGGGGTAGGGGGCAAGGGG + Intergenic
980524075 4:133966799-133966821 ACTTGGGGGTAGGGTGGGAGTGG + Intergenic
982450999 4:155552328-155552350 ACTTGGGGCTGCTGGGGGAGGGG + Intergenic
984797056 4:183671446-183671468 AGTTGGGGCTGCGGGGGATGAGG - Intronic
985804626 5:2033422-2033444 ACTGGGGGCCCCGGGGGAAATGG - Intergenic
987155398 5:15084001-15084023 ACTTGGGGCGGCGGGGGTTGAGG + Intergenic
992607340 5:78472383-78472405 ACTTGGGGGTGGGGGGCAAGGGG - Intronic
993287119 5:86013947-86013969 AGTGGGGGCTAGGGGGTAAGTGG - Intergenic
995752065 5:115462460-115462482 ACTTGGGGCTACAGAGATAGGGG + Intergenic
997965636 5:138353409-138353431 ACTTGGGGCTCTGGGAGAAAAGG - Intronic
999679723 5:154045462-154045484 TCTTGGGGGTTGGGGGGAAGGGG - Intronic
999929017 5:156410371-156410393 ACTGGGGGCTACTGGGGAGGGGG + Intronic
1000041255 5:157486704-157486726 ACTTGGGGTTACAGGAGAACAGG - Intronic
1001702536 5:173717894-173717916 GGGTGGGGCTGCGGGGGAAGGGG - Intergenic
1006083579 6:31581210-31581232 GCTTGGGACTTCTGGGGAAGTGG + Intronic
1006990387 6:38210063-38210085 ACGTGGGGAGACAGGGGAAGGGG + Intronic
1007847557 6:44772424-44772446 ACTTGGGGGTCAGGGGGATGGGG + Intergenic
1008115997 6:47551016-47551038 CTTTGGGGCCTCGGGGGAAGAGG + Intronic
1011404719 6:87006908-87006930 ACTGGGGCCTGCGGGGGGAGTGG + Intronic
1012974296 6:105763512-105763534 ACCTGGGTCTTCAGGGGAAGTGG - Intergenic
1015849183 6:137553831-137553853 ACTTGGGGCGAAGGGTGAAAGGG - Intergenic
1019194418 6:170272812-170272834 CCTCGGGGCTGCGGGGGGAGAGG + Intergenic
1019868425 7:3735326-3735348 GCCTGGGGCTGTGGGGGAAGGGG - Intronic
1022289566 7:28987955-28987977 ACCTGGGGCTAGGGAGAAAGGGG + Intergenic
1022522729 7:31018454-31018476 GCTTGGGCCTACGTGGGCAGAGG - Intergenic
1023972421 7:45000628-45000650 ACCTGGGGCTGCAGAGGAAGTGG + Intronic
1024044968 7:45579956-45579978 AATGGGGGCGAGGGGGGAAGGGG - Intronic
1027512194 7:79096782-79096804 ACTTGGGACTCTGGAGGAAGGGG - Intronic
1029193493 7:98788142-98788164 ACCTGGGGCTCCTGGGGAGGTGG + Intergenic
1031777120 7:125918533-125918555 ACTTGCTGCTAAGGGTGAAGGGG - Intergenic
1031879200 7:127177142-127177164 ACTCGGGGCTACTGGGGGTGGGG + Intronic
1032451735 7:132037277-132037299 ACTGGGGGCCAGGGAGGAAGTGG - Intergenic
1033138332 7:138803107-138803129 ATTTGTGGCTAATGGGGAAGGGG + Exonic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1034461751 7:151201384-151201406 GCTTTGGTCTACAGGGGAAGTGG + Intronic
1037693155 8:21200512-21200534 ACTTGGGGGACCGGTGGAAGGGG + Intergenic
1038693290 8:29782586-29782608 ATTTGGTGCAAGGGGGGAAGAGG - Intergenic
1038975934 8:32696062-32696084 ACCTGGGGCTGGGGGTGAAGAGG - Intronic
1041090480 8:54297012-54297034 ACTTGGGGCAATGGGGCAATGGG + Intergenic
1041506419 8:58603377-58603399 ACATGGTGCTCTGGGGGAAGAGG + Exonic
1041685882 8:60644226-60644248 GCTTGCAGCTACAGGGGAAGAGG - Intergenic
1042357999 8:67850589-67850611 ACCAGGGGCTAGGGGGAAAGGGG - Intergenic
1043372365 8:79610390-79610412 ACCTGGGGACATGGGGGAAGAGG - Intergenic
1043519831 8:81033044-81033066 CCTTAGGGCTAGGGGAGAAGGGG + Intronic
1049764923 8:144350716-144350738 ACAAGGGGCCACGGGGGAAGAGG - Intergenic
1051278420 9:15418715-15418737 ACTTGGAGCTACTGGGGCTGAGG - Intergenic
1051445613 9:17135706-17135728 ACTTGGGCTTGGGGGGGAAGCGG - Intronic
1051547705 9:18294709-18294731 ACTTGGGGGTATGAGAGAAGGGG - Intergenic
1052595503 9:30552570-30552592 ACTTGGGGGAAAGGGGGCAGGGG - Intergenic
1052655112 9:31349124-31349146 ACTGGGGGCTACTGGGGTTGGGG + Intergenic
1053062348 9:35042278-35042300 GCTTGGGGCTAAGGGGGATATGG + Exonic
1055834127 9:80419094-80419116 AGCTGGGGTTCCGGGGGAAGAGG + Intergenic
1055990075 9:82096111-82096133 ACTGGGGACTACTGGAGAAGGGG - Intergenic
1057818710 9:98315103-98315125 AGGTGGGGTTGCGGGGGAAGGGG - Intronic
1057995015 9:99813934-99813956 ACTCGGTGCAACGGTGGAAGAGG + Intergenic
1061488714 9:130933696-130933718 CCTTGGGGGTTCTGGGGAAGCGG + Intronic
1061544798 9:131298496-131298518 AGTTGGGGCTAGTGGGGTAGGGG - Intronic
1062426089 9:136506905-136506927 ACTTGGGGCTCCGGGACACGGGG + Exonic
1186452869 X:9687873-9687895 CCAGGGGGCCACGGGGGAAGCGG - Intronic
1189252771 X:39613983-39614005 GCTTGGGGAGACGGGGGAGGCGG + Intergenic
1190080434 X:47352984-47353006 ACTAGGGGCTGGGGGTGAAGGGG - Intergenic
1190642843 X:52496401-52496423 ACTTTGGGGTGGGGGGGAAGTGG + Intronic
1190644830 X:52516466-52516488 ACTTTGGGGTGGGGGGGAAGTGG - Intronic
1192809233 X:74535086-74535108 CCTTGGGGCTGCTGGGGAAGGGG - Intergenic
1193328188 X:80206870-80206892 ACTTTAGGCTATAGGGGAAGTGG + Intergenic
1193892518 X:87068072-87068094 CCTTGGGGCTATGGAGCAAGTGG - Intergenic
1194198949 X:90931982-90932004 ACTTGGGGGCATGGGGGATGGGG - Intergenic
1199697279 X:150351696-150351718 AGCTGGGGCTTTGGGGGAAGTGG + Intergenic
1200544944 Y:4508414-4508436 ACTTGGGGGCATGGGGGATGGGG - Intergenic