ID: 1096789282

View in Genome Browser
Species Human (GRCh38)
Location 12:54034900-54034922
Sequence CCCTCTCCTTTGTTCCCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096789269_1096789282 19 Left 1096789269 12:54034858-54034880 CCGGCCCGCGCCACAGGACCCTC 0: 1
1: 0
2: 2
3: 18
4: 231
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789270_1096789282 15 Left 1096789270 12:54034862-54034884 CCCGCGCCACAGGACCCTCGCCG 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789274_1096789282 1 Left 1096789274 12:54034876-54034898 CCCTCGCCGGACCCTCTAACCTC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789275_1096789282 0 Left 1096789275 12:54034877-54034899 CCTCGCCGGACCCTCTAACCTCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789273_1096789282 9 Left 1096789273 12:54034868-54034890 CCACAGGACCCTCGCCGGACCCT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789277_1096789282 -10 Left 1096789277 12:54034887-54034909 CCCTCTAACCTCGCCCTCTCCTT 0: 1
1: 0
2: 1
3: 28
4: 335
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789268_1096789282 20 Left 1096789268 12:54034857-54034879 CCCGGCCCGCGCCACAGGACCCT 0: 1
1: 0
2: 2
3: 24
4: 193
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789271_1096789282 14 Left 1096789271 12:54034863-54034885 CCGCGCCACAGGACCCTCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 101
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170
1096789276_1096789282 -5 Left 1096789276 12:54034882-54034904 CCGGACCCTCTAACCTCGCCCTC 0: 1
1: 0
2: 1
3: 10
4: 210
Right 1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096789282 Original CRISPR CCCTCTCCTTTGTTCCCGGC TGG Exonic
900633737 1:3651982-3652004 CCCTCACCCCTGTTCCCCGCCGG + Intronic
901958804 1:12808417-12808439 CACTCTCCTTTGTGCCCCTCAGG - Intergenic
902096349 1:13949131-13949153 CCCTCTCCTCTGTACCCAGAGGG + Intergenic
903338013 1:22637701-22637723 GCCTCCCCTTTCTTCCCGTCTGG - Exonic
903651156 1:24923211-24923233 TCCTCTCCTTTGTACCTGGGAGG - Intronic
905743439 1:40392364-40392386 CCCTATCCTTAGGTCCTGGCAGG + Intronic
906211951 1:44016999-44017021 CCCCCTCCTTGGTGCCAGGCAGG - Intronic
911645043 1:100328796-100328818 CCCGTTCCTTTGTTTCCTGCAGG + Intergenic
917537522 1:175885030-175885052 CCCTCGCCATTGTTCTTGGCAGG + Intergenic
920013072 1:202884425-202884447 CCCTCTCCTTTGGTCTGGGCAGG + Intronic
920418123 1:205812475-205812497 CTCCCTCCTGTGTTCCTGGCAGG + Intronic
923015263 1:230121479-230121501 CCCTCTTCTTTGTCCCTGCCAGG + Intronic
924325772 1:242892620-242892642 GCCTCTCCCTTGTGCCTGGCTGG + Intergenic
1067714548 10:48679588-48679610 CCCTTTCCTTTTTTACAGGCTGG + Intergenic
1069843192 10:71352811-71352833 CCCGCTCCTTTTTACCTGGCTGG - Intronic
1070931001 10:80260543-80260565 CTTTCTCCTTTGTTCGGGGCGGG - Intergenic
1074967249 10:118502108-118502130 CCCTCTCCTTTGAACTCGGCAGG - Intergenic
1075810141 10:125219122-125219144 CCCTCTCCTTGGTCACCCGCTGG + Intergenic
1076576706 10:131474354-131474376 CGCTCTCCTTTGTTTCCTGCTGG - Intergenic
1078758884 11:14235858-14235880 CTCTCTCCTTTGTTTCCTCCAGG - Intronic
1080637809 11:34139061-34139083 GCCTCTCCTTCTTTCCAGGCTGG - Intronic
1081672590 11:44950194-44950216 CTCCCGCCATTGTTCCCGGCAGG - Intronic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1083201723 11:61124865-61124887 CCCTCTCCTTTCTTCCTGGGAGG - Intronic
1083316251 11:61816522-61816544 CCCTCTCCTGTGCCCCCGCCTGG + Intronic
1083609212 11:63997254-63997276 CCCTCCCCTTTACTCTCGGCCGG + Intronic
1083886173 11:65574470-65574492 CCTTCTCCTTCCTTCCCGGCAGG - Intergenic
1084111274 11:67015497-67015519 CCCTTCCCTTTGTTCCCAGCTGG - Intronic
1085410659 11:76288532-76288554 CCCGCTCCTTTGTGCAGGGCTGG - Intergenic
1085618896 11:78022793-78022815 CCTTCTCCCTTGCTCCCGGTGGG - Intronic
1088075652 11:105845410-105845432 CCCTCTCCTTGTCTCCAGGCAGG - Intronic
1089487483 11:118858283-118858305 CCCTTTCCTTTGTGCTGGGCAGG + Intergenic
1090495986 11:127212697-127212719 CCAGCTCCTTTGTTCCCTGCTGG + Intergenic
1091381739 12:66576-66598 CCCTCTCCTCTCTGCCCTGCAGG + Intergenic
1091712770 12:2753356-2753378 CCCTCTCCTCTCTGCCCAGCGGG - Intergenic
1092045983 12:5432204-5432226 TCCTCTCCTTTTTCCCCTGCTGG + Exonic
1092155343 12:6278649-6278671 CCCTGCCCTGTGTTCCCGGGAGG + Intergenic
1095038649 12:37420105-37420127 TCCTCTCCTCTGTTCCTGGGTGG - Intergenic
1096789282 12:54034900-54034922 CCCTCTCCTTTGTTCCCGGCTGG + Exonic
1097225685 12:57475776-57475798 CCCACTCCCTTGGTCCCGGCCGG + Intronic
1101131096 12:101692068-101692090 CACTCTCATTTGTTCCCTGTTGG - Intergenic
1102202696 12:111068605-111068627 TTTTCTCCTGTGTTCCCGGCAGG + Intronic
1105497131 13:20939932-20939954 TCTTGTCCTTTGTTCCCAGCTGG - Intergenic
1107307584 13:39038615-39038637 CCCTCTCCTGGCTTCCCGTCTGG + Exonic
1108180834 13:47838198-47838220 TCCTCTCCTTTGTTTCCTGAGGG + Intergenic
1113374914 13:109756101-109756123 CTCTTTCCCTTGTTCCCGGATGG - Exonic
1114645223 14:24252374-24252396 CCCTTTCCTTACTTCCAGGCAGG + Intronic
1118315785 14:64725352-64725374 CCTGCCCCTTTGTTCCCTGCTGG + Intronic
1118702725 14:68450036-68450058 GCCTCTCCTTTGTTCCCCTAGGG - Intronic
1118811943 14:69281586-69281608 CTCTCTCCTTTGTTGCCAGCAGG + Intronic
1120934495 14:89881032-89881054 CCCTCTCCTGTGGTCTCTGCAGG + Intronic
1122567257 14:102668620-102668642 CCCTCTCCTTTTTTGCAGGGGGG + Intronic
1125786438 15:42322543-42322565 CCCCCTCCTTTGGTGCCAGCAGG - Intronic
1125964241 15:43860264-43860286 TCCTCTCCTTTGTTGCTGGTTGG + Intronic
1126207418 15:46061020-46061042 CTTTCTCCTTTGATGCCGGCAGG + Intergenic
1128421340 15:67494171-67494193 CCCTCTCATTTGTGCCTGTCTGG - Intronic
1128862092 15:71082660-71082682 CCCCCTCCCCTGTTCCCGCCTGG - Intergenic
1129776148 15:78237727-78237749 TCCTCTCCTTCCCTCCCGGCTGG + Intronic
1132840109 16:1974741-1974763 CCCTCACCTTGCTTCCCCGCAGG + Exonic
1132870540 16:2113855-2113877 CCCTCTGCTGTGTTCTCGCCTGG - Intronic
1132959277 16:2613094-2613116 CCCCGTCCTGTGTTCACGGCCGG + Intergenic
1132972337 16:2695069-2695091 CCCCGTCCTGTGTTCACGGCCGG + Intronic
1134035928 16:11031452-11031474 CACTCACCTGTGTTCCCGCCTGG + Intronic
1134521992 16:14923049-14923071 CCCTCTGCTGTGTTCTCGCCTGG + Intronic
1134622075 16:15696985-15697007 TCCTCTCCTCTGCTCCCTGCAGG + Intronic
1134709662 16:16321700-16321722 CCCTCTGCTGTGTTCTCGCCTGG + Intergenic
1134949941 16:18346945-18346967 CCCTCTGCTGTGTTCTCGCCTGG - Intergenic
1135602758 16:23797118-23797140 CTCTCTCTTTTGTCCCCAGCAGG - Intergenic
1137500763 16:49010338-49010360 CCCTCTTCTTTGGTCTGGGCAGG - Intergenic
1138243400 16:55447036-55447058 ACCTATCCTTAGTTCCAGGCCGG - Intronic
1142619598 17:1156357-1156379 GCCTCTCCTGAGTTCCTGGCTGG + Intronic
1142971565 17:3615281-3615303 GCCTGTCCTTTCTACCCGGCAGG - Intronic
1143729003 17:8869751-8869773 CACTGTCCTTTGTTCCTGGCTGG - Intergenic
1147141057 17:38460883-38460905 CCCACTCCTCTGTTCCCTGCAGG + Exonic
1148554775 17:48571809-48571831 CTCTCTCCTTTGTCCCTGGGTGG - Intronic
1150388714 17:64779079-64779101 CCCTCTTCCTTGTTGCCTGCAGG - Intergenic
1153823941 18:8857129-8857151 CCCTCTCCTCTGCGTCCGGCAGG + Intergenic
1158409475 18:57192721-57192743 TCCTTTCCTTTGTTCCCTGTGGG - Intergenic
1158950310 18:62488327-62488349 CTCTCTCCTTGGCTCCCAGCTGG + Intergenic
1160221414 18:76980533-76980555 CCCTCTTCTGTGGTCCCGGGTGG + Intronic
1160832375 19:1109873-1109895 CCCTCTCCTGTGCTCTCGGGGGG - Intronic
1160986110 19:1839692-1839714 CCCTGCCCTTTGTGCCCTGCAGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161595449 19:5148897-5148919 CCATGTCCTTGGTTCCCAGCAGG + Intronic
1162106606 19:8373683-8373705 CCCTCTCCCCTGACCCCGGCAGG + Exonic
1165090923 19:33388081-33388103 CCCTCACCTCTGTTCCCCACAGG - Exonic
1166010111 19:39935393-39935415 CCCTCACTGTTGTTCCTGGCAGG - Intergenic
1166769309 19:45271450-45271472 CCCTCTCCTTCTCTCCCTGCAGG + Exonic
1166782917 19:45351721-45351743 CCCTTTCCTCTGTTCTCTGCAGG - Exonic
925277728 2:2662307-2662329 GCCTCTCCTGAGTTGCCGGCAGG + Intergenic
926436834 2:12846831-12846853 CCCTCTTCTTTGTTCTGGGCCGG - Intergenic
929764061 2:44829731-44829753 CTCTCTCCTTGGGTCCCAGCTGG - Intergenic
930377015 2:50580713-50580735 CCCTCTCCTTTGTGGCAGTCTGG + Intronic
931984504 2:67728619-67728641 CCCTCTCCTTGCTTCCTGCCTGG + Intergenic
932492988 2:72133307-72133329 ACCTCTCCTCTGTGCCCTGCAGG - Exonic
933405994 2:81860397-81860419 CCCACTCCTTTGTACCCTACTGG + Intergenic
934686490 2:96325494-96325516 GCCACTGCTTTTTTCCCGGCAGG - Intronic
934847252 2:97669805-97669827 CCCTCTTCTTTGTTCTCTGCTGG + Intergenic
936671464 2:114662075-114662097 CCCTCTGCTCTGTTCCTAGCAGG + Intronic
942277040 2:174330851-174330873 CCTTCTCCCTTGTTCATGGCAGG + Intergenic
942414434 2:175744023-175744045 CTCTCTCCTTTGATCCATGCCGG - Intergenic
945404118 2:209424195-209424217 CCCTCTCCTTTTTCTCCGGAGGG + Intronic
946812358 2:223539404-223539426 CTCTCTGCTTTGCTCCCAGCTGG - Intergenic
948165801 2:235861651-235861673 CCCTCTCCTTAGTTCCAGGAAGG + Intronic
948540969 2:238691293-238691315 CCCTCCCCTTTCTCCCAGGCTGG + Intergenic
948573765 2:238936665-238936687 CTGTCTCCTTTATTCCCTGCTGG + Intergenic
948702524 2:239769212-239769234 TGCTCTTCTTTGTTCCTGGCTGG - Intronic
1169326591 20:4681729-4681751 CCCACTCCTCTGCTCCCCGCAGG + Intergenic
1170460561 20:16573382-16573404 CCCGCCCCTCTGCTCCCGGCCGG + Exonic
1171183620 20:23109553-23109575 CCCTCTCCTGAGGTCCAGGCAGG + Intergenic
1173024917 20:39298842-39298864 CCGTCTCCTTTTTTCGCAGCTGG + Intergenic
1173853919 20:46237604-46237626 CCCCCTCCTTGGTTCCCAGCTGG + Intronic
1174239644 20:49123154-49123176 CCTTCTCCTTTTTTGCCTGCTGG + Exonic
1175014730 20:55777418-55777440 TCCTCTCCATTTTTCCCGGAAGG + Intergenic
1175886414 20:62293763-62293785 CCCCCTCCCTTGTATCCGGCAGG + Exonic
1175913516 20:62415443-62415465 GCCCCTCCTTTGTCCCGGGCAGG - Intronic
1176283467 20:64328257-64328279 CCCTCTCCTCTCTGCCCTGCAGG - Intergenic
1178176267 21:30103182-30103204 CTCTCTCCATTGTACCCAGCAGG - Intergenic
1184378959 22:44133088-44133110 CCCCCTCCTTTTTTCCCCCCAGG + Intronic
1185196153 22:49470732-49470754 CCCTCTCCTTTGGTTCCCGTGGG - Intronic
950722127 3:14891016-14891038 CACTCTCATTTGTTCTGGGCTGG - Intronic
954702295 3:52456568-52456590 TCCTCCCCTTTGTTCCCGCAGGG + Intronic
955070081 3:55565406-55565428 CTCTCTCCTCTCTTCCCAGCAGG - Intronic
956184590 3:66550536-66550558 CCCTCTGCTTTATTCCTTGCTGG + Intergenic
956389965 3:68761040-68761062 CCCTGTCTTTTGTTACCAGCAGG - Intronic
962575694 3:136752821-136752843 CGCTTTCCTCTGTTCCCGCCCGG + Intergenic
967619839 3:191619629-191619651 CCGTCTCAATTGCTCCCGGCTGG + Intergenic
968599193 4:1501225-1501247 CCCACTCCTCTCTTCCCTGCAGG - Intergenic
968935431 4:3607771-3607793 CCGTCTCCTCTGTCCCGGGCCGG - Intergenic
972564584 4:40258672-40258694 CCCTCCCCTTTCTTCCTGGGGGG - Intergenic
974413524 4:61573504-61573526 CCCTCTCCATTATTCCCTTCAGG + Intronic
979351459 4:119648649-119648671 CCCTATCCTTTGATCCCAGGAGG - Intergenic
979929761 4:126616645-126616667 CCCTCTCCTTCGGTCCAGTCTGG - Intergenic
980923873 4:139115255-139115277 CCCTCTCCTGCGGTCCCGGGGGG + Intronic
981720617 4:147797827-147797849 CCCTCTGCTATGTTCCCTGAGGG + Intronic
982661331 4:158210408-158210430 CCCTCCCCTCTCCTCCCGGCCGG + Exonic
985333846 4:188870508-188870530 CCTTCTCCGTTGCTCCCGCCTGG + Intergenic
985911460 5:2887324-2887346 GTTTCTCCTTTGTTCCTGGCGGG + Intergenic
986063594 5:4214374-4214396 CCCTATCCTTTGCTCCCGTCTGG - Intergenic
988391541 5:30640126-30640148 CCCTCTCCTTCATTCCCTACTGG + Intergenic
996770206 5:127077744-127077766 CCTTCTTCTTTGTGCCTGGCAGG - Intergenic
998594108 5:143510110-143510132 CCCTCTCTTTGGTTCCTTGCTGG - Intergenic
999434924 5:151556087-151556109 CCCTCTCCTTCACTCCCTGCAGG + Intronic
999767806 5:154754813-154754835 CCCCCTCCCCTGTGCCCGGCGGG - Intronic
1004157714 6:13184718-13184740 CCCTGTCCTGTGTTCCCCGCTGG + Intronic
1004604203 6:17178503-17178525 CCCTCCCTTTTCTTCCAGGCTGG + Intergenic
1006677801 6:35776725-35776747 CCCTCTCCTGCGGTCGCGGCCGG - Intronic
1006806770 6:36793957-36793979 CCCTCCCCTTCTTTCCCGGTTGG - Intronic
1006817313 6:36860924-36860946 TCATCTACTTTGTTCCAGGCAGG + Intronic
1007577117 6:42932404-42932426 CCCACTCTTTTTTTCCGGGCAGG - Intronic
1011395964 6:86908112-86908134 TCCTCTCCTTTTTTCCCTGAAGG - Intergenic
1014432597 6:121388512-121388534 CCCTCTCCTTCCATCCCTGCAGG + Intergenic
1016732877 6:147445221-147445243 CCCTCTCCTTTGCTTTCTGCAGG - Intergenic
1017607326 6:156148044-156148066 CCCTCTCTTTTGCACCCTGCAGG - Intergenic
1018061953 6:160096954-160096976 CCCTCTCCTTAGCTCCTGGGAGG + Intronic
1021678669 7:23106600-23106622 CCCCCTCCTGTGTTCCCCGGTGG + Intronic
1022973517 7:35537394-35537416 ACCTCTCATATGTTCCAGGCAGG - Intergenic
1024452398 7:49563247-49563269 CTCTCTCCTTTTTTTCTGGCAGG - Intergenic
1031843682 7:126778313-126778335 ATCTCTCCTTTGTGCCTGGCAGG + Intronic
1032113432 7:129096520-129096542 CTCTTTCCTTTGCTCCAGGCAGG + Intergenic
1036487689 8:9194434-9194456 GCCTCTCCTCTGTTCCCTGCAGG + Intergenic
1037857633 8:22383277-22383299 TCCTTTTCTTTGTTCCCTGCTGG + Intronic
1038304304 8:26384668-26384690 ACCTCTGCTTTGCTCCCAGCCGG - Intronic
1038481536 8:27905169-27905191 CCCTCTCCTTTGTTTTCCCCTGG - Intronic
1039554816 8:38468162-38468184 CCGGCTCCATTGTTCCCGCCCGG - Intronic
1039932165 8:42003097-42003119 TCCTCTAGTGTGTTCCCGGCTGG - Intronic
1040047616 8:42979443-42979465 CCCACTCCTTTGTTATCAGCTGG + Intronic
1040286664 8:46103914-46103936 CCCCCACCTTTGTCCCAGGCGGG - Intergenic
1045863338 8:106837614-106837636 CCCTCTACTATGTTCCCAGAAGG + Intergenic
1047170885 8:122491244-122491266 CCCTCTCCTTGAATCCAGGCTGG - Intergenic
1049007475 8:139864642-139864664 CGCTGTCCATTGCTCCCGGCAGG - Intronic
1049261173 8:141640066-141640088 CCCTCTCCTTTCTCCTCGCCGGG + Intergenic
1051742315 9:20263827-20263849 CCCTCTCCCTTGTGCCCTCCTGG + Intergenic
1054454747 9:65424085-65424107 CCGTCTCCTCTGTCCCGGGCTGG + Intergenic
1055795844 9:79974110-79974132 CCTTCTCCTTTGTTCCCACTGGG + Intergenic
1057022637 9:91712167-91712189 CCCTCTCTTGTGTTCACTGCTGG - Intronic
1057603050 9:96475666-96475688 CCCTCTCCTGAGTTACCAGCAGG - Intronic
1058646999 9:107140050-107140072 CTTTCCCCTTTGTTGCCGGCTGG - Intergenic
1060782332 9:126422048-126422070 ACCTCTCTTTTCTTCCCTGCAGG + Intronic
1060832424 9:126724798-126724820 CCCTCTCCTTTGTTTCCGTGTGG + Intergenic
1060920497 9:127417393-127417415 CTCTCTCCTTTGCTCTCTGCTGG + Intergenic
1061000364 9:127899239-127899261 GCCTCTCTTTTCTTCCCAGCTGG - Intronic
1061238692 9:129356983-129357005 CCCTCTCTCTTCTTCCCTGCTGG + Intergenic
1061897319 9:133655189-133655211 CCCTCCCCTTTGATCCCACCTGG - Intronic
1062326482 9:136014913-136014935 CCCTCCCCATTGTTCCCAGAGGG - Intronic
1192634122 X:72802220-72802242 CCCTTTCCTTTTATCCCAGCTGG - Intronic
1192647588 X:72918581-72918603 CCCTTTCCTTTTATCCCAGCTGG + Intronic
1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG + Intergenic
1198817104 X:140603340-140603362 CCCTCTCCTTTGTTTACAGGTGG + Intergenic
1201223222 Y:11791160-11791182 GCCTCTCCCTTGTGCCTGGCTGG + Intergenic