ID: 1096791390

View in Genome Browser
Species Human (GRCh38)
Location 12:54047344-54047366
Sequence CTGCAGCGGCCCCGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096791390_1096791402 25 Left 1096791390 12:54047344-54047366 CCCGCGCCGCGGGGCCGCTGCAG 0: 1
1: 0
2: 1
3: 39
4: 287
Right 1096791402 12:54047392-54047414 GGACCATTTCGTTGGAATGTAGG 0: 1
1: 0
2: 1
3: 4
4: 57
1096791390_1096791395 0 Left 1096791390 12:54047344-54047366 CCCGCGCCGCGGGGCCGCTGCAG 0: 1
1: 0
2: 1
3: 39
4: 287
Right 1096791395 12:54047367-54047389 AGCCGGTCTCCCGAGCACCGCGG 0: 1
1: 0
2: 1
3: 6
4: 40
1096791390_1096791397 4 Left 1096791390 12:54047344-54047366 CCCGCGCCGCGGGGCCGCTGCAG 0: 1
1: 0
2: 1
3: 39
4: 287
Right 1096791397 12:54047371-54047393 GGTCTCCCGAGCACCGCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 115
1096791390_1096791403 26 Left 1096791390 12:54047344-54047366 CCCGCGCCGCGGGGCCGCTGCAG 0: 1
1: 0
2: 1
3: 39
4: 287
Right 1096791403 12:54047393-54047415 GACCATTTCGTTGGAATGTAGGG 0: 1
1: 0
2: 1
3: 4
4: 54
1096791390_1096791401 17 Left 1096791390 12:54047344-54047366 CCCGCGCCGCGGGGCCGCTGCAG 0: 1
1: 0
2: 1
3: 39
4: 287
Right 1096791401 12:54047384-54047406 CCGCGGCAGGACCATTTCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096791390 Original CRISPR CTGCAGCGGCCCCGCGGCGC GGG (reversed) Intronic
900191845 1:1355411-1355433 CTGCCCCGACCCCGCGGCCCCGG + Intronic
900557375 1:3287308-3287330 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557389 1:3287355-3287377 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557403 1:3287402-3287424 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557431 1:3287497-3287519 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557525 1:3287834-3287856 CTGCAGCCGCCCCGCCACGCGGG + Intronic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
901085998 1:6613097-6613119 CTGCTCCGGGCCCGCGGGGCCGG - Intronic
901316736 1:8314884-8314906 CTGCAATGGCCCCGTGGGGCTGG - Intergenic
901879685 1:12186391-12186413 CTGCACTGGCCCAGCGGTGCTGG + Intronic
903774476 1:25783802-25783824 CTGCGGCGGCCCCAGGGCGGCGG - Exonic
904941048 1:34165043-34165065 CTGCGGCTGCCCCGCGGGGAGGG - Exonic
905108484 1:35577689-35577711 GTGCCTCTGCCCCGCGGCGCTGG - Intronic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
906197181 1:43936402-43936424 CCGCGGGGGCCGCGCGGCGCGGG + Exonic
906662604 1:47593495-47593517 CTGGAGCGCCCACGGGGCGCGGG + Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
915143900 1:153783478-153783500 CAGCCGCAGCCCAGCGGCGCAGG - Intergenic
916651684 1:166839654-166839676 CTGCCGCGGCCCAGCCGCCCGGG - Intronic
918349001 1:183635190-183635212 CGGCCGCGCCCTCGCGGCGCTGG - Intronic
920121832 1:203664652-203664674 GTGCAGGGGCCCCACGGGGCTGG + Intronic
921190039 1:212700314-212700336 CTGCGTCCGCCCCCCGGCGCGGG + Intergenic
921472718 1:215567703-215567725 CGGCAGCTTCCCCGCGGCGGCGG + Exonic
922481903 1:225945049-225945071 CTGCATCGGCCCCTCAGCACAGG + Intergenic
922933500 1:229407722-229407744 CTGCTGAGGCTCCGCGCCGCAGG + Intergenic
924052371 1:240092075-240092097 CTGCTGCGCCGCCGCGCCGCGGG - Exonic
1062832384 10:614437-614459 CTGCAGAGGACCCGGGGCACAGG + Intronic
1062929649 10:1344554-1344576 CTGCAGCGGCCTGGCGGGTCAGG - Intronic
1063115417 10:3068516-3068538 TGTCAGCGGCGCCGCGGCGCGGG + Intronic
1063569539 10:7202148-7202170 CTGCAGGGGCCCCACGTGGCAGG - Intronic
1065101594 10:22336535-22336557 CTGCCGCGGCGCGGCCGCGCCGG - Intergenic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1065712576 10:28532546-28532568 CAGCAGCGGCCCGAAGGCGCCGG + Intronic
1067237694 10:44465569-44465591 CTCCAGAGGCCCCGCAGTGCTGG + Intergenic
1067853292 10:49768927-49768949 CTGCCGCGGCCGCGCCCCGCTGG + Intergenic
1068637376 10:59362614-59362636 CAGCAGGGGCCCAGCGGCACGGG + Intronic
1072220779 10:93325924-93325946 CTTCAGGGGCCCCGAGGTGCTGG + Exonic
1072555919 10:96513615-96513637 CTGCCGCTGCCTCGCGGCGCCGG - Exonic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072710678 10:97713923-97713945 CTGCAGGCGCACCGCGCCGCGGG - Exonic
1074377435 10:112951435-112951457 CAGCGGCGGCCGCGCGGAGCGGG - Intronic
1076735727 10:132458109-132458131 CAGCAGAGGCCCCGCGACGTGGG + Intergenic
1077008548 11:370048-370070 CGGCGGGGGCCCCGGGGCGCGGG + Intronic
1077105955 11:842733-842755 CTGCCGCGGCCGCGCGGGCCCGG - Intergenic
1077419833 11:2444976-2444998 CGGCAGCGGCCCCCCGCGGCGGG + Exonic
1079362002 11:19777280-19777302 CAGCAGCGGCCCCGGGGCGGGGG + Intronic
1080230919 11:30017096-30017118 CTGCACCCGCCCCGCCGCGCCGG - Intergenic
1081573528 11:44305879-44305901 CCGCAGCGGCCCCGCGTCTCGGG + Intronic
1081867154 11:46366314-46366336 CAGCAGCGGCCCAGCAGCGTGGG + Exonic
1084146148 11:67266415-67266437 CGGCGGCGGCTCCGGGGCGCGGG + Exonic
1084562247 11:69911565-69911587 CTGCAGCGGCCCCAGAGAGCAGG + Intergenic
1085047614 11:73362672-73362694 CTGCAGCGTCCCCGAGGGGCTGG - Exonic
1089153997 11:116386443-116386465 CTGCAGCAGCTCTGCGGCCCTGG + Intergenic
1089299334 11:117489202-117489224 CTGCAGCTGCCCCGCCGCAGAGG - Intronic
1090277485 11:125430085-125430107 CTGCAGCACCCCCGCAGCGATGG - Exonic
1091590657 12:1841056-1841078 CTGCAGTGGCCCCACGACACTGG + Intronic
1091923094 12:4321221-4321243 GTGCAGGGGCAGCGCGGCGCGGG + Exonic
1092096673 12:5848575-5848597 CTGCTGGGGCCCCGTGGTGCAGG - Intronic
1093707290 12:22288530-22288552 CTGCAGGAGCCCCGCGGTGTGGG + Intronic
1093979488 12:25459889-25459911 CTGCAGCGGCCCCAAGGGACTGG + Intronic
1096427580 12:51517140-51517162 CTGCAGAGGCCCCGTGGTGCAGG - Intergenic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1098255433 12:68611081-68611103 CGGCGGCGGCCGCGCGGGGCCGG + Intronic
1098416877 12:70243852-70243874 CGGCAGCGGCTCCTCCGCGCTGG - Intronic
1102101556 12:110281927-110281949 CTGCAGGGGCCCGGCGCGGCCGG + Intronic
1102256433 12:111418201-111418223 CGGCGGCGGCCCCGCGGGGCTGG + Exonic
1102501883 12:113358727-113358749 GCCCAGCGGCCCCCCGGCGCTGG - Exonic
1103377710 12:120469619-120469641 CTGCGGCGGGCCCGCGGCGTCGG - Exonic
1103507632 12:121452635-121452657 CGGCAGTGGCCCCGCGCCGCTGG - Intronic
1103983545 12:124752163-124752185 GTGCAGCCGCCCCGCGGCCACGG - Intergenic
1104602428 12:130162585-130162607 CTGGAGCGGGCTGGCGGCGCGGG - Exonic
1104931938 12:132344390-132344412 CTGCAGCGTCACCACCGCGCGGG + Intergenic
1105539000 13:21298297-21298319 GAGCAGCGGCTCTGCGGCGCAGG + Intergenic
1107467984 13:40666455-40666477 CTGCCCCGGCCCGGCGGCTCTGG - Exonic
1110497874 13:76190314-76190336 CAGCTGCCTCCCCGCGGCGCAGG + Intergenic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1113591783 13:111506529-111506551 CTGCAGCGGCCCAGCCTCCCAGG - Intergenic
1113755752 13:112809496-112809518 CTGCAGCGGGCCCGTGGCACAGG + Intronic
1114209280 14:20601652-20601674 CTGCCGTGTCCCCGCGGGGCTGG - Intronic
1114483247 14:23048046-23048068 GTCCAGCGGCTCCGCGGGGCCGG + Exonic
1119260909 14:73237642-73237664 CTGCAGAAGCCCCGGGGTGCGGG - Intronic
1119666941 14:76491594-76491616 CTCCAGCAGCCCCGCGAGGCGGG - Exonic
1120780038 14:88479070-88479092 CCGCAGAGGCCCAGCGGCCCTGG - Exonic
1120780241 14:88479963-88479985 CTACAGCAGGCCCGCGGCGCTGG - Exonic
1121168833 14:91836343-91836365 CGGCCGCGGCCGCGCGGCGCCGG - Intronic
1121690836 14:95876363-95876385 CAGCAGCGGCGCCGCGGGGCGGG + Intergenic
1121828894 14:97033282-97033304 CTGCTGCGGCCCCGGGGCGGCGG - Intergenic
1122551438 14:102552239-102552261 CTGCAGGGGCCCCTGGGCGTGGG - Intergenic
1122582024 14:102777239-102777261 CAACGGCGGCGCCGCGGCGCGGG - Intergenic
1123066296 14:105621110-105621132 CTGCAGCGGCCACATGGCCCAGG + Intergenic
1123070439 14:105640162-105640184 CTGCAGCGGCCACATGGCCCAGG + Intergenic
1123075029 14:105663822-105663844 CTGCAGCGGCCACATGGCCCAGG + Intergenic
1123089674 14:105736950-105736972 CTGCAGCGGCCACATGGCCCAGG + Intergenic
1123709817 15:22979481-22979503 CAGCGGCGACCACGCGGCGCTGG + Intronic
1124121461 15:26892410-26892432 CTGCTGGGCCCCCGGGGCGCGGG - Intronic
1124249356 15:28096964-28096986 CGGCAGCGGCGCCGCGGGGAGGG - Intronic
1124497623 15:30196125-30196147 CGGCGGCGGCCTCGCGGGGCAGG + Intergenic
1124745966 15:32342566-32342588 CGGCGGCGGCCTCGCGGGGCAGG - Intergenic
1124973710 15:34514633-34514655 CGGCGGCGGCCTCGCGGGGCAGG - Intergenic
1125689623 15:41585536-41585558 CTGCAGGGGCCCCGCGCCCACGG - Intergenic
1127488167 15:59438170-59438192 CGGCTGCGGGCCCGCGCCGCGGG - Exonic
1129287989 15:74541189-74541211 CGGAAGCGGCGCCGCGGGGCTGG - Exonic
1129483218 15:75843857-75843879 CGGCCGCGGCCCCGCGGGGCAGG + Intronic
1129709860 15:77815265-77815287 CTGCAGAGGCCCTGAGGCCCCGG + Intronic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1130564580 15:84982286-84982308 TTGCCCCGGACCCGCGGCGCCGG + Exonic
1132055884 15:98649833-98649855 CTGCAGCGGACCCGGGACCCGGG + Intronic
1132357094 15:101179780-101179802 CTGCCTCCGCCCCGTGGCGCAGG + Intronic
1132597847 16:761438-761460 CTGCAGAGGCCCCTCAGAGCAGG + Intronic
1132665144 16:1078131-1078153 CTGCAGCCGCCCCGTGGGGAGGG + Intergenic
1132719645 16:1309471-1309493 CTGGGGCGGACCCGGGGCGCGGG + Intronic
1132719806 16:1309978-1310000 CTGCGGCGGCCCGGCCGCTCGGG - Intronic
1132826864 16:1909503-1909525 CTGCAGCTGCCCTGAGGGGCAGG - Intergenic
1132889381 16:2196491-2196513 CGGCGGCGGCCCCGCGGCACCGG + Exonic
1133046784 16:3092539-3092561 CACCAGCGGCCCCGCGTGGCTGG + Exonic
1133072261 16:3254426-3254448 CTGCAGCCTCCCCGCGGAGCTGG + Exonic
1133213117 16:4273818-4273840 CGGCAGCGGCCCCCGGGCGCAGG + Intergenic
1134134109 16:11668487-11668509 CCGCAGCAGCCCCGCGGGCCCGG - Exonic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1134490883 16:14694426-14694448 CTCCAGAGGCCGCGGGGCGCTGG + Exonic
1134496264 16:14733544-14733566 CTCCAGAGGCCGCGGGGCGCTGG + Intronic
1135821778 16:25692074-25692096 CTGCAGCGCCCCCGCTTCCCCGG - Exonic
1136535039 16:30894142-30894164 CCGGAGCGGCCCGGTGGCGCGGG + Exonic
1138659218 16:58507942-58507964 CTGCAGCTGCCCCGTGATGCTGG + Exonic
1140909413 16:79438094-79438116 CAGCAGAGGCCCCGTGGCGTTGG + Intergenic
1141526947 16:84617911-84617933 CCGCTGCGGCTCCGCGGCGATGG - Exonic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1143487166 17:7261466-7261488 CAGAAACGGCCCCGGGGCGCGGG - Intronic
1143627508 17:8118890-8118912 CCGCAGCGGCCCCGCGCGGCCGG + Exonic
1143830289 17:9645638-9645660 CTGCCGCGTCCCCGGGGCCCAGG - Exonic
1146142435 17:30379336-30379358 CAGCAGCGGCCCCGCAGCGTCGG - Exonic
1146492650 17:33293222-33293244 GGGCAGCGGCCGCGCGACGCTGG + Intronic
1147612800 17:41811657-41811679 CTGCAGCGGCCCCGCGCCCGCGG - Exonic
1148836569 17:50468844-50468866 CAGCAGCGGCGGCGGGGCGCGGG + Exonic
1151459964 17:74248635-74248657 CTGCAGCTGCCCTGGGGCCCAGG + Intronic
1152677224 17:81647910-81647932 CTGCAGCTCCCCCGGGGTGCAGG + Exonic
1152721810 17:81927261-81927283 CGGCGGCGGACCCGCGGAGCCGG - Intronic
1153285374 18:3450914-3450936 CCGCGGCGGTCCCGCGGCCCCGG - Intronic
1155806314 18:30175376-30175398 CTGCCGCGGGCCGGTGGCGCCGG + Intergenic
1155928811 18:31685101-31685123 CCGCGGCGGCCGCGGGGCGCCGG - Intronic
1156451019 18:37266567-37266589 CTGCAGGGGGTCCGCGGCGGTGG + Exonic
1157591894 18:48841276-48841298 CTGGAGCGGCCCCTGGGCTCTGG + Intronic
1158976546 18:62715875-62715897 CGGCAGCGGCAGCGGGGCGCGGG + Exonic
1161304037 19:3557218-3557240 CAGCAGCAGCCCCGCGCCGCGGG + Exonic
1161447996 19:4328717-4328739 CTGCTGCGGCCCAGCGGGGACGG - Exonic
1161767352 19:6214963-6214985 CTGCAGCTGCCTCCCGGCTCTGG + Intronic
1162818039 19:13207895-13207917 CTGCGGGGGCCCCGAGCCGCCGG + Exonic
1163436941 19:17301542-17301564 CTCCAGTGGCCCCACGGCGTTGG + Exonic
1163563994 19:18038861-18038883 CTGCTGCTGCCTCGCTGCGCTGG - Intergenic
1163830333 19:19544494-19544516 CTGCAGCTGCTCCGCGGAGCCGG - Exonic
1165080367 19:33302984-33303006 CTGCAGCCTCCCCGGGACGCGGG - Intergenic
1165274260 19:34734333-34734355 CCGCAGGCGCCCCGCGTCGCTGG - Intronic
1165331469 19:35143088-35143110 CTGCTGGGGCCCAGTGGCGCTGG - Intronic
1165924867 19:39320759-39320781 CTGCAGCGGCCCGGGAGCGGCGG - Intergenic
1166930309 19:46298026-46298048 CGGCAGCGGCCCCAGGGCACAGG - Intronic
1167042742 19:47032285-47032307 CCGCCGCGGCCCCGCAGCGCTGG + Exonic
1167045188 19:47045504-47045526 CCGCTACGGCCCCGCGGAGCTGG + Exonic
1167376455 19:49114664-49114686 CACCAGCGGCCCTGCGGCCCCGG - Intronic
1167472061 19:49680779-49680801 CTGCAGGGGCCTCGCGCCGAAGG + Intronic
1168123916 19:54272398-54272420 CACCAGCAGCCCCTCGGCGCTGG - Intronic
1168294135 19:55370440-55370462 CTGCCGCGGCCCTGCTGCTCAGG - Intronic
1168332629 19:55579061-55579083 CTCCCGGGGCTCCGCGGCGCTGG + Exonic
1168642642 19:58040331-58040353 CTGCAGCACCCCTGAGGCGCAGG - Intronic
928904372 2:36355468-36355490 CCGCAGCGCACCCGCGGCGCCGG + Intergenic
928904728 2:36356660-36356682 CTGCGCCGCCCCCTCGGCGCTGG + Intronic
932252694 2:70258319-70258341 GCGCAGCGGCCGCCCGGCGCGGG - Intronic
932314070 2:70768060-70768082 GTGCAGCGGCTCCGCGGCGGCGG + Exonic
933655220 2:84881159-84881181 CAGCAGCGGCCACGTGGGGCCGG + Exonic
934526779 2:95056940-95056962 CTGGAGCGGCCCTGGGGCGCTGG - Intergenic
935196682 2:100820381-100820403 CCGGAGCGGCCCCGCGGGGCCGG - Exonic
935237522 2:101151150-101151172 CTGCAGCGGCGCCGCGGGCACGG - Exonic
936047220 2:109197155-109197177 CTGCTGCAGCCCTGCGGCCCAGG + Intronic
936153567 2:110034656-110034678 CTGCAGCAGCCCCTGGGCCCAGG + Intergenic
936191114 2:110336759-110336781 CTGCAGCAGCCCCTGGGCCCAGG - Intergenic
937065068 2:119011599-119011621 CTGCAGCGACCCCGCGTGCCGGG - Intergenic
938368816 2:130756208-130756230 CTCCAGGGGCCCCGCGGGGTCGG - Intronic
940830162 2:158457349-158457371 CCGCGGCGGCCGCGAGGCGCTGG - Intronic
941095991 2:161239382-161239404 CTGCAGTGGCCGCGCCCCGCTGG + Intergenic
944676005 2:202034460-202034482 CTGCGGCGCCTTCGCGGCGCGGG + Intergenic
948423863 2:237876104-237876126 CTGGAGCTGCCCCGATGCGCCGG - Intronic
948805812 2:240453163-240453185 CTGCGGCGGCCAAGCGGGGCAGG - Intronic
948837114 2:240631207-240631229 CTGCCGCTGCCCCTCGGGGCTGG + Exonic
1169345155 20:4823331-4823353 CTGCATCGCGCCCGCGCCGCAGG + Intronic
1172008596 20:31833660-31833682 CTGCAGCTGCCCCCCTGCCCTGG + Intronic
1173166326 20:40689333-40689355 CCTCCGCGGCCCAGCGGCGCAGG + Intergenic
1174204282 20:48827862-48827884 CTAGCGCGGCCGCGCGGCGCCGG + Exonic
1175259902 20:57667755-57667777 CTGCAGAGCCCCAGCGGCCCTGG + Intronic
1175806209 20:61830565-61830587 CTGCAGCGGCCCCGCCTCCCAGG + Intronic
1176122036 20:63458328-63458350 CTGCAGCGGCCTCGAGGGCCAGG - Intronic
1176133634 20:63508594-63508616 CTGCAGCGGCCGTGAGGCTCCGG - Intergenic
1176705976 21:10120200-10120222 CTCCAGTGGCCCCCGGGCGCAGG - Intergenic
1177920301 21:27143751-27143773 CCGCAGCGGCGCCTCGGCCCCGG - Intergenic
1179209671 21:39314021-39314043 CCGCAGGGGCCCCGAGTCGCGGG + Intronic
1179980824 21:44894839-44894861 CTGCAGCTGGCCCACGGGGCAGG + Intronic
1180043857 21:45293900-45293922 CTGCAGGCCCCCCGGGGCGCTGG - Intergenic
1180960686 22:19761043-19761065 CGGCGGCGGGCCCGGGGCGCCGG - Exonic
1180961909 22:19766080-19766102 CTGGAGCGCCCCGGGGGCGCAGG - Intronic
1180962066 22:19766593-19766615 GTGCAGCGGCTCCGATGCGCCGG - Exonic
1181934545 22:26429384-26429406 AGGCGGCGGCTCCGCGGCGCCGG + Exonic
1182441316 22:30365938-30365960 CTGCAGCAGCCACGTGGCTCTGG + Exonic
1183649421 22:39145582-39145604 CTGCACTGGGCTCGCGGCGCCGG + Intronic
1184667557 22:45996830-45996852 CTGCAGCGGCCCCGCCCGTCCGG + Intergenic
1184698015 22:46150530-46150552 ACGCGGCGGCCCCGCGGCGGGGG + Intronic
1185296702 22:50058288-50058310 CGGCGGCGGCCCCGGGGCGTGGG + Intergenic
1185309454 22:50146046-50146068 ATGCAGAGGCCCCGCGGTGGGGG + Intronic
953980611 3:47411125-47411147 CAGCTGCGGCGCCTCGGCGCAGG - Exonic
954277949 3:49554645-49554667 CCGCTGCCGCCCGGCGGCGCCGG + Exonic
954367537 3:50154615-50154637 GTGCGTGGGCCCCGCGGCGCAGG - Intergenic
955228282 3:57078783-57078805 CTGCGGGTGCCCCGCGGGGCTGG + Intronic
955927635 3:64023408-64023430 CTCCAGCGGCATCGCGGCGAAGG + Exonic
956420231 3:69080016-69080038 CCGCAGCGGGCCCGGGGGGCTGG - Intronic
961116480 3:124334298-124334320 CTGCAGCGGCCCCTGAGCCCTGG + Exonic
964509745 3:157437743-157437765 CTGCAGGCGACCCGCGACGCGGG + Exonic
968132082 3:196197836-196197858 CTGCAGAGGCCCCGGGGCGCAGG + Intronic
968830499 4:2931071-2931093 CACCAGGGGCCCCGCGGCCCTGG + Exonic
968887421 4:3341854-3341876 CTGCAGAGGCCCCGGGGTGTGGG + Intronic
969321664 4:6416640-6416662 CTGCAGCCACCCCGATGCGCTGG + Intronic
969721110 4:8893473-8893495 CTGCCGCGGCCCGGCGCCCCGGG - Intergenic
972412864 4:38810583-38810605 CTGCAGCAGCCCCCTGGCTCAGG - Intronic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
974047272 4:56908354-56908376 CGGCGGCGGCCCCGCCGGGCGGG + Intronic
975870769 4:78776352-78776374 CTGCAGCGGAGCCGCGGAGCGGG + Intronic
977176556 4:93827396-93827418 CTGCACCGCCCCTGGGGCGCGGG - Intergenic
977908155 4:102501141-102501163 CCGAAGCGGCCCCGAGGGGCGGG + Intergenic
978189659 4:105896438-105896460 CCGGAGCGGCCCCGGAGCGCGGG - Intronic
983296327 4:165873472-165873494 CAGCAGCGGGGACGCGGCGCGGG + Exonic
984778653 4:183505084-183505106 CTGCGGGGTCCCCGCGGCGCCGG + Exonic
984795869 4:183659419-183659441 CTGCAGCGGGCCCGGGGCGTGGG + Exonic
985996479 5:3599985-3600007 TTGCAGCGGCGCCCCGGCGGAGG - Exonic
986333702 5:6736989-6737011 CCTCAGGGGCCCCGCGGCCCAGG - Intronic
994043614 5:95284653-95284675 CTCCCGGGTCCCCGCGGCGCTGG + Intergenic
994083320 5:95731535-95731557 CTGCGTCGGCCCCGCCGCGGTGG + Exonic
997990807 5:138543136-138543158 CGGCGGCGGCTCCGCGGCGGCGG + Exonic
998449883 5:142226016-142226038 CAGGAGCGGCCCCCCGGTGCAGG + Intergenic
999768153 5:154755992-154756014 CTGCAGCTGCCCGGCGCCGAAGG + Intronic
1001381984 5:171311327-171311349 CGCCGGCGGCCCCGCGGTGCCGG + Intronic
1002067216 5:176657894-176657916 CCGCAGCGGCCTCGAGGTGCAGG - Exonic
1002190137 5:177473606-177473628 CTGCAGAGGCTCCGAGGCGGCGG - Intronic
1002887827 6:1312044-1312066 CTGCGGCGGCTCCGCGGGGGCGG - Intergenic
1003114367 6:3273500-3273522 CTGCAGGGGCCCTGCTGCCCTGG + Intronic
1003624098 6:7727065-7727087 CAGCAGCTGCCCCCCGGCGGCGG - Exonic
1004043953 6:12009173-12009195 CTGGCGCGGCCCCGCGGCCCCGG - Intronic
1006472733 6:34237536-34237558 CCGCAGGGCGCCCGCGGCGCGGG - Intronic
1007327481 6:41073277-41073299 CTGCAGGGGCCGCCCCGCGCGGG + Intronic
1007435313 6:41806325-41806347 CTGCACACGCCCCGCGACGCGGG - Exonic
1007739514 6:44002280-44002302 CTGCCACGGCCCCGCGGGGGAGG - Intronic
1010438068 6:75859131-75859153 CAGCAGAGGCCCCGGGGCTCAGG + Intronic
1012916880 6:105179997-105180019 CCGGAGCGGCGCGGCGGCGCGGG + Intergenic
1015127121 6:129767447-129767469 CTGCAGCGGCGCAGCAGCGGGGG - Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017717209 6:157221405-157221427 CAGAAACAGCCCCGCGGCGCCGG + Intergenic
1018034054 6:159866787-159866809 CTGCAGGGGCCACGCTGCCCGGG + Intergenic
1019133976 6:169896910-169896932 CTGCAGCGGCCCCTCTCCCCAGG - Intergenic
1019190061 6:170246430-170246452 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190101 6:170246533-170246555 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190166 6:170246705-170246727 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190192 6:170246774-170246796 CTGCAGCCGCCCCCCAGCTCCGG + Intergenic
1019190217 6:170246843-170246865 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190231 6:170246878-170246900 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019190284 6:170247015-170247037 CTGCAGCCGCCCCCCAGCACCGG + Intergenic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1020105716 7:5421395-5421417 CGGCGGCGGGCCCGCGGCCCGGG + Exonic
1023939744 7:44761914-44761936 CAGCACCGCCCCCTCGGCGCAGG - Intronic
1023981547 7:45073534-45073556 CTGCAGCAGCTCAGTGGCGCTGG - Exonic
1024579847 7:50793019-50793041 CCGCTGCGGGCCCGGGGCGCCGG + Intronic
1024965356 7:55019034-55019056 CTGCTGCGGCCGCGCTGCGCCGG - Intronic
1029423547 7:100483791-100483813 CGGGAGCGGCCGTGCGGCGCGGG - Intergenic
1029640161 7:101815651-101815673 CTCCAGCGCCCCCTCGGGGCCGG + Intergenic
1031483447 7:122304021-122304043 CTGCAGCGGCAGCGCGTCGCGGG + Exonic
1032013570 7:128361660-128361682 CTGCCGCGGAGCCCCGGCGCGGG - Exonic
1034188383 7:149196001-149196023 GTGCGGAGGCCCCGCGGGGCGGG + Intronic
1034400032 7:150856272-150856294 AGGCAGCGGCCCGACGGCGCTGG + Intronic
1035751817 8:2001863-2001885 CAGCTGCGGCCCCACGGCGTCGG - Exonic
1036910536 8:12754573-12754595 CGCCAGCGGCCCAGCGGCCCCGG + Intronic
1036910751 8:12755344-12755366 CGGCCTCGGCCCTGCGGCGCTGG + Exonic
1037835895 8:22214525-22214547 GTGCAGCTGCCCCTCTGCGCAGG + Intergenic
1037947798 8:22999969-22999991 CAGCAGCAGCGCGGCGGCGCCGG + Intronic
1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG + Intronic
1039948809 8:42152469-42152491 CTGCCGCGGCCCAGTGGGGCTGG + Intergenic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040495175 8:47959973-47959995 GAGCAGCAGCCCCGCGGTGCTGG - Exonic
1040871158 8:52101111-52101133 CTGCAGCCTCCCCACGGCCCGGG - Intergenic
1041108817 8:54466994-54467016 CAGAAGAGGCCCCGCGGCCCGGG + Intergenic
1043436433 8:80240102-80240124 CAGCTGCGGGCCCGCGGGGCTGG + Intergenic
1044781648 8:95749914-95749936 CTGCAGCGGCCCCGAGGTGAGGG - Intergenic
1046661184 8:116949890-116949912 CAGCTGCCTCCCCGCGGCGCAGG - Intergenic
1049446077 8:142632268-142632290 CTCCAGCGCCCCGGCGGCCCTGG - Intergenic
1049746849 8:144266635-144266657 AGGTAGCGGCCCGGCGGCGCCGG - Exonic
1049773385 8:144393934-144393956 CTTCAGTGGCCCCCCGGCACGGG + Exonic
1049919011 9:346010-346032 CTGCAGAGGGCCCGAGCCGCTGG - Intronic
1051929068 9:22363730-22363752 CTGCACAGGGCCCGAGGCGCTGG + Intergenic
1053079457 9:35162240-35162262 CTGCCGCGCCCCAGCCGCGCCGG - Exonic
1053482302 9:38424523-38424545 CTGCGGGCGCCCCGCGGTGCAGG - Intergenic
1053643252 9:40107318-40107340 CTCCAGTGGCCCCCGGGCGCAGG - Intergenic
1053762899 9:41358172-41358194 CTCCAGTGGCCCCCGGGCGCAGG + Intergenic
1054541503 9:66269285-66269307 CTCCAGTGGCCCCCGGGCGCAGG + Intergenic
1054790050 9:69248193-69248215 CTGCACCGGCTCCGAGGAGCGGG - Exonic
1057483189 9:95461802-95461824 GGGCAGCGGCCCCGCAGCCCTGG + Intronic
1057570839 9:96203175-96203197 CTGCAGAGTCCCAGTGGCGCAGG - Intergenic
1058861256 9:109119697-109119719 GTGCTGCGGCGCCGCGGTGCTGG - Exonic
1058967149 9:110048785-110048807 AGGCAGCGGCCGCGCGGCGCTGG + Exonic
1059405831 9:114098080-114098102 CGGCGGCGCCCCCGCGGGGCGGG - Intronic
1060375453 9:123112322-123112344 CCCCAGCAGCCCCGCGGGGCAGG - Intronic
1060417856 9:123445331-123445353 CTGCTGCGGCCCAGCGGCCAGGG + Intronic
1061052158 9:128203355-128203377 GGGCGGGGGCCCCGCGGCGCAGG + Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061941513 9:133886664-133886686 GTGCAGGTGCCCCGCGGAGCAGG - Intronic
1062162637 9:135088392-135088414 CTCCCCCGGCCCCGCGGCGAGGG - Intronic
1062277230 9:135736738-135736760 CTGCTGCCGGCCCGCGGCGGGGG + Intronic
1062375867 9:136261682-136261704 CTGCAGAGGCCCCTCTGGGCTGG + Intergenic
1062414267 9:136439836-136439858 CGGGCGCGGCCCCGCGGCGGCGG - Intergenic
1062556350 9:137114865-137114887 GGGCAGCGGCCGCGGGGCGCGGG - Intronic
1202791010 9_KI270719v1_random:90288-90310 CTCCAGTGGCCCCCGGGCGCAGG - Intergenic
1185469417 X:373722-373744 CTGCAGCGCCCCGCCGGCCCCGG - Intronic
1185642363 X:1595543-1595565 CGGGAGCGGGCCCTCGGCGCTGG + Intronic
1187226133 X:17376401-17376423 CCGGAGCGGCGCCGCGGGGCTGG - Intronic
1187448585 X:19377970-19377992 CTGCAGGGGCCTCGCCGGGCTGG + Intronic
1189324955 X:40106385-40106407 GTGCGGCGGCCCCGCGGGCCCGG + Intronic
1189332840 X:40153797-40153819 CTGCTGCGGCCCCGAGCCTCCGG - Intronic
1189335597 X:40168964-40168986 CTGCAGCGGCCTGGGGGCTCTGG + Intronic
1192363270 X:70452444-70452466 CGGCAACGGCCCCGCCCCGCTGG + Intronic
1192657039 X:73003183-73003205 CGGCAGCGGCCCGGCGGCAGCGG + Intergenic
1192665081 X:73079818-73079840 CGGCAGCGGCCCGGCGGCAGCGG - Intergenic
1196828364 X:119758367-119758389 CTGCAGCTCCCCCGGGTCGCGGG - Intergenic
1196828506 X:119758855-119758877 CTGCAGCGGGCTCAGGGCGCCGG + Exonic
1197415266 X:126165972-126165994 CGGCGGCGGCCCGGCGGCGGTGG + Intergenic
1199976519 X:152897872-152897894 CTCCAGCAGCCCCGCGGGGCGGG + Intergenic
1200098156 X:153673755-153673777 CTGCACCTGCTCCGGGGCGCGGG - Intronic