ID: 1096791393

View in Genome Browser
Species Human (GRCh38)
Location 12:54047350-54047372
Sequence CCGCGGGGCCGCTGCAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096791385_1096791393 -2 Left 1096791385 12:54047329-54047351 CCACAGCCTGAGAGTCCCGCGCC 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG 0: 1
1: 0
2: 2
3: 21
4: 246
1096791388_1096791393 -8 Left 1096791388 12:54047335-54047357 CCTGAGAGTCCCGCGCCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG 0: 1
1: 0
2: 2
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096791393 Original CRISPR CCGCGGGGCCGCTGCAGAGC CGG Intronic
900082656 1:870036-870058 CCGCGGCCCCGCTGGAGGGCAGG - Intergenic
900162055 1:1228494-1228516 ACGCGGAGCCGCGGCGGAGCCGG - Exonic
900166584 1:1246464-1246486 TCGCGGGGCAGCTTCGGAGCTGG - Intronic
900195881 1:1375222-1375244 CCGGGTGGCCGCTGCCGATCGGG - Intronic
900340273 1:2185252-2185274 CCGCGGGGACCCTGCCGAGGGGG + Exonic
900364800 1:2306735-2306757 CAGCGAGGGCGCTGCGGAGCTGG + Exonic
900744632 1:4352747-4352769 CCGCAGGTCCGCAGCAGGGCTGG - Intergenic
901727432 1:11253084-11253106 CCGCGGTGGCCCTGCAGAGTAGG + Intronic
901879683 1:12186385-12186407 CCGCTGGGCCAGTGCAGACCTGG - Intronic
902053642 1:13583272-13583294 CCGGGGGGCTGCCCCAGAGCTGG - Intergenic
902532248 1:17097969-17097991 ACGCTGTGCAGCTGCAGAGCAGG - Intronic
903049065 1:20587523-20587545 CAGCTGGGCCGCTGAAGAGTTGG - Intergenic
904237477 1:29124279-29124301 CTGCGGGACCGGGGCAGAGCAGG - Intergenic
904384330 1:30131670-30131692 CCCCTGGGCTGCTGCAGGGCGGG + Intergenic
904775087 1:32901431-32901453 CCGCGGGGGCGCTGCGGGGCCGG - Intronic
905630208 1:39514361-39514383 ACGGGGGGCCTCTTCAGAGCAGG + Intronic
905667552 1:39771829-39771851 ACGGGGGGCCTCTTCAGAGCAGG - Intronic
912401555 1:109397743-109397765 CCGCTGCGCCGCTGCCGCGCTGG - Exonic
912709624 1:111941150-111941172 GAGCAGGGCCTCTGCAGAGCTGG + Intronic
916651687 1:166839660-166839682 CGGCTGGGCCGCGGCAGAGGCGG + Intronic
917788798 1:178486744-178486766 CCGAGAGGCCGCAGCAGGGCTGG + Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
920211797 1:204333763-204333785 CCCCAGGGCAGCTGGAGAGCAGG - Intronic
922514552 1:226197260-226197282 CCGCCTGGGAGCTGCAGAGCTGG + Intergenic
923630064 1:235643948-235643970 AGGCGGGGACGCGGCAGAGCAGG + Intronic
1063067087 10:2621061-2621083 CTGGGGGGCCTCTGCAGAGCTGG + Intergenic
1063115603 10:3069193-3069215 TCCCGGGGGCGCTGCAGGGCGGG - Intronic
1067090231 10:43262691-43262713 CCCCGGGCCCCCTGCACAGCAGG + Intronic
1067562107 10:47311371-47311393 CAGCCAGGCTGCTGCAGAGCAGG - Intronic
1067792634 10:49299527-49299549 CCGCTGGGCCGATGCTGTGCTGG + Intronic
1069685648 10:70316736-70316758 CCTCGGTGCGGCTGCACAGCTGG + Intronic
1069818276 10:71212417-71212439 GGGCGCGGCCGCGGCAGAGCTGG - Intergenic
1070646093 10:78203420-78203442 CCCCAGGCCAGCTGCAGAGCTGG - Intergenic
1070954350 10:80454508-80454530 CCGCGGGGCCGCTCCTGGGCAGG - Intronic
1072421692 10:95295057-95295079 CAGCTTGGCCTCTGCAGAGCTGG + Intergenic
1073152704 10:101322685-101322707 CAGCGGAGCCGCTGGTGAGCGGG + Intergenic
1075796482 10:125123673-125123695 CCCCGGGGCCCCTGGGGAGCCGG - Intronic
1076000105 10:126906632-126906654 GCGCGGGGCTGCTGCTGAGACGG - Intronic
1076836217 10:133022282-133022304 CCGCGGCCCCCATGCAGAGCCGG - Intergenic
1077037721 11:503349-503371 CCCCGGGGCTGCTTCAGAGGCGG + Exonic
1077217413 11:1400747-1400769 CCGCAGGGCCCAGGCAGAGCCGG - Intronic
1077281696 11:1748977-1748999 CCGGGGGGCTGCGGCAGACCCGG - Intronic
1078371626 11:10751276-10751298 CCGCGGCGCCGCTGGAGCTCTGG - Exonic
1081491865 11:43575575-43575597 GGGCTGGGCAGCTGCAGAGCAGG - Intronic
1081673880 11:44957158-44957180 CAGCGGGGCCGCTGCCGAGGCGG + Intergenic
1083620210 11:64045487-64045509 CCGTGGGGCAGCTGGAGAGGGGG + Intronic
1084421919 11:69064497-69064519 CCCCGGGGCAGCCGCAGAGGAGG - Intronic
1084522892 11:69675282-69675304 CCGCGGTGCCGTAGCAGACCCGG + Exonic
1084600612 11:70143221-70143243 CCACTGGGCAGCTACAGAGCGGG + Intronic
1086424760 11:86672350-86672372 ACGCGGTCCCGCTGCGGAGCAGG + Exonic
1086724675 11:90167430-90167452 CGCCGCGGCCGCTGCACAGCCGG + Intronic
1089740305 11:120577732-120577754 CCACTGGGCAGCTGCTGAGCTGG + Intronic
1090658181 11:128861598-128861620 CCTGGGAGCCACTGCAGAGCGGG + Intronic
1091732353 12:2890649-2890671 TCGCGGGGCCGGTACTGAGCGGG - Intronic
1093464893 12:19439582-19439604 CGCCGACGCCGCTGCAGAGCAGG - Intronic
1094541234 12:31364706-31364728 CAGCAGCGCTGCTGCAGAGCTGG + Intergenic
1095774000 12:45992003-45992025 CGGCGGGGCCGCGGCAAAGTGGG - Intronic
1096427582 12:51517146-51517168 CCACGGGGCCTCTGCAGAGCTGG + Intergenic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG + Intronic
1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG + Intronic
1101420313 12:104545292-104545314 CCTCAGGGCTTCTGCAGAGCTGG + Intronic
1102256426 12:111418195-111418217 CCGCGGGGCCGCCGCCGGGGAGG - Exonic
1104983414 12:132583672-132583694 CCCCCGGGCCGCCGCGGAGCCGG + Exonic
1105071429 12:133236190-133236212 CCTCGGCTCCGCTGCAGGGCGGG - Intergenic
1107770968 13:43787135-43787157 CCACGGGGCGGCAGCAGAGGAGG + Intergenic
1108618529 13:52159250-52159272 CCGCGGGGCAACTGCACCGCGGG + Intronic
1111488415 13:88936357-88936379 CTGCGGGGGTGCTGCACAGCAGG + Intergenic
1112050633 13:95641810-95641832 CCTCTGGGCCGCTGGCGAGCGGG + Exonic
1113746521 13:112749060-112749082 CCCTGGGGCCCCAGCAGAGCTGG - Intronic
1113788838 13:113016697-113016719 CCTCGGGGCCTTTGCACAGCCGG + Intronic
1114474085 14:22981976-22981998 CCGCGGGGCCGCCGCCCACCCGG - Exonic
1116945420 14:50831113-50831135 CCGGGTGGCCGCGGCCGAGCCGG - Exonic
1121358197 14:93232312-93232334 CCTCGGGGCGCCTGCAGGGCAGG - Intergenic
1121439846 14:93941706-93941728 CCCCGGGGCCGCTGGACAGATGG + Intronic
1122789521 14:104178468-104178490 CTGCGGGGACGCTGCGGAGCCGG - Intronic
1122838572 14:104443368-104443390 CCCAGTGGCAGCTGCAGAGCAGG + Intergenic
1122903998 14:104793648-104793670 CTGGTGGGCCGCTGCAGGGCGGG - Exonic
1122970880 14:105151748-105151770 CCGCGGGGAGGGGGCAGAGCTGG + Intronic
1122971945 14:105155903-105155925 CCACGTGGCCGCTGAAGTGCAGG + Exonic
1125422028 15:39513540-39513562 CCAGGGGGCCTCTGCAGAACTGG - Intergenic
1125516414 15:40323682-40323704 CCGCGCGGCCACTGGAGACCAGG + Intergenic
1125689626 15:41585542-41585564 GCGCGGGGCCCCTGCAGGGACGG + Intergenic
1126746445 15:51830137-51830159 CCGCTGAGCCGCGGCCGAGCTGG + Intronic
1128910405 15:71508534-71508556 CCGCAGGCCCTTTGCAGAGCTGG - Intronic
1129440769 15:75579365-75579387 CCGCGGGGCGGCCGCAGCGTTGG - Intergenic
1129612218 15:77070419-77070441 CCGCGGGGACGCTGCGGAGCCGG - Intronic
1129933691 15:79432179-79432201 TCCCGGGGCCGCTGGAGCGCGGG + Intergenic
1130260841 15:82353106-82353128 CAGCAGGGCAGCTGCAGAGTGGG - Intergenic
1130280392 15:82515900-82515922 CAGCAGGGCAGCTGCAGAGTGGG + Intergenic
1130471765 15:84232083-84232105 CAGCAGGGCAGCTGCAGAGTGGG + Intergenic
1130479259 15:84346654-84346676 CAGCAGGGCAGCTGCAGAGTGGG + Intergenic
1130492511 15:84441475-84441497 CAGCAGGGCAGCTGCAGAGTGGG - Intergenic
1130594062 15:85236721-85236743 CAGCAGGGCAGCTGCAGAGTGGG + Intergenic
1131515298 15:93072916-93072938 CTGCGGGGAAGCTGCAGAGAAGG + Exonic
1131517527 15:93089061-93089083 TCCCCGGGCCGCTGCTGAGCCGG - Intronic
1132334968 15:101042458-101042480 CCCCTGGGCTGCAGCAGAGCAGG - Intronic
1132580994 16:684552-684574 CCGCGGGGCAGCTGGCGGGCGGG - Intronic
1132594036 16:740242-740264 CCGCGGGGCCAGAGCTGAGCAGG - Intronic
1132703734 16:1232310-1232332 CCCTGGGGCTGCTGCAGGGCTGG + Intergenic
1132704776 16:1239051-1239073 CCCTGGGGCTGCTGCAGGGCTGG - Intergenic
1132707784 16:1254085-1254107 CCCTGGGGCTGCTGCAGGGCTGG - Intergenic
1132806864 16:1778950-1778972 CCTGGGGGCCCCTGCAGGGCTGG - Intronic
1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG + Exonic
1133046781 16:3092533-3092555 ACGCGGGGCCGCTGGTGAGAGGG - Exonic
1133056039 16:3145906-3145928 CCGGGGGCCGGCTGCAGAGAGGG - Exonic
1133056884 16:3149820-3149842 CCACGGGGGCGCTGCTGAGACGG + Exonic
1133101804 16:3484548-3484570 CCGCTAAGCCTCTGCAGAGCTGG - Intronic
1134018795 16:10907451-10907473 CCCCGGGGCCCTGGCAGAGCTGG + Exonic
1134539866 16:15055833-15055855 CCGAGGGGAAGCTGCAGGGCGGG - Intronic
1135315019 16:21437361-21437383 CTGCGTGGCTGCTACAGAGCTGG + Intronic
1135367945 16:21869629-21869651 CTGCGTGGCTGCTACAGAGCTGG + Intronic
1135443872 16:22501520-22501542 CTGCGTGGCTGCTACAGAGCTGG - Intronic
1136311686 16:29416022-29416044 CTGCGTGGCTGCTACAGAGCTGG + Intergenic
1136325130 16:29517817-29517839 CTGCGTGGCTGCTACAGAGCTGG + Intergenic
1136366557 16:29811825-29811847 ACGCGGGGAGGCTGCAGAGGAGG - Intronic
1136439817 16:30257799-30257821 CTGCGTGGCTGCTACAGAGCTGG + Intergenic
1138595550 16:58027274-58027296 CCGCGGGACCCATCCAGAGCGGG - Intronic
1139700905 16:68707472-68707494 CCTGTGGGCAGCTGCAGAGCTGG + Intronic
1141736836 16:85859726-85859748 CCGCGGGGCCGCTGGAGGCTAGG + Intergenic
1141990090 16:87604359-87604381 CAGGCGGGCAGCTGCAGAGCCGG - Intronic
1142041701 16:87898308-87898330 CCGCGGGGGAGTGGCAGAGCTGG + Intronic
1142130003 16:88428090-88428112 CCCCGGGGCCCCCCCAGAGCAGG + Exonic
1142150093 16:88508878-88508900 CCGCGGGGCCCCTGAGGACCTGG - Intronic
1142418252 16:89954766-89954788 GAGCGGGGCAGCTGCAGAGACGG + Intronic
1142672979 17:1495948-1495970 ATGAGGGGCCGCTGCAGTGCAGG - Intronic
1143584060 17:7842687-7842709 CCGCGGGACCGGTGGTGAGCCGG + Intronic
1143719401 17:8799244-8799266 CCGCGGCGCCGCCCCAGACCGGG - Exonic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145273441 17:21416676-21416698 CCGCGGGGCCTCTCCCCAGCCGG - Exonic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1146343233 17:32040314-32040336 CCCCGGGGCAGGCGCAGAGCTGG + Intronic
1148049001 17:44759981-44760003 CTGCGGGGCAGCTGCTGAGGGGG - Intronic
1148079504 17:44960002-44960024 CCACCGGCTCGCTGCAGAGCCGG - Exonic
1148821240 17:50360850-50360872 TATCGGGGGCGCTGCAGAGCTGG + Exonic
1151780177 17:76240350-76240372 CCGCAGCGCCGCAGCGGAGCCGG - Exonic
1152377100 17:79924550-79924572 TGGAGGGGGCGCTGCAGAGCAGG - Intergenic
1152546915 17:81004617-81004639 CCGCGGGGCCGCTGCGGGAAAGG - Intronic
1152703882 17:81833131-81833153 CCGCGGGTGCCCTGCAGGGCCGG - Intronic
1153291844 18:3509472-3509494 CCCCAGGGACACTGCAGAGCTGG - Intronic
1153794840 18:8611955-8611977 CCCCTGGCCTGCTGCAGAGCGGG + Intronic
1155199982 18:23508700-23508722 ACACGGGGCCACTGCAGGGCAGG - Intronic
1155928722 18:31684805-31684827 CCGCGGCGCCCCTGCGGAGAGGG + Intronic
1157374410 18:47150183-47150205 GCGCGGGGCCACTGCAAAGAGGG + Intronic
1160411428 18:78677830-78677852 CCGAGAGGTCACTGCAGAGCTGG - Intergenic
1160909869 19:1469467-1469489 GCGGGGGGCCGCTGCCGGGCCGG - Exonic
1163282333 19:16325383-16325405 CCGCGGGGGCGCTGTAGGGCGGG - Exonic
1164455777 19:28405495-28405517 CTGCGGTGCAGCTGGAGAGCAGG - Intergenic
1164639104 19:29811885-29811907 CCGCGCGGCCGCTGAGGGGCTGG + Exonic
1167738696 19:51311729-51311751 CCCCCGGGCCGGTGCAGCGCAGG + Intergenic
1168076356 19:53982621-53982643 CGGCGGGGCGGGTGCCGAGCGGG + Exonic
1168240432 19:55086437-55086459 CAGCGGGGCCGAGCCAGAGCTGG - Exonic
924985257 2:264461-264483 CCGCGGGTCACCTGCAGGGCGGG - Intronic
925226737 2:2189991-2190013 CCTCAGGGCCACTGCACAGCTGG + Intronic
925262901 2:2543348-2543370 AGGCAGGGCCACTGCAGAGCCGG - Intergenic
925294009 2:2765991-2766013 CCACGGGGCAGCTGCAGACTGGG - Intergenic
925867136 2:8238224-8238246 CCACTGGGCTGCTTCAGAGCAGG + Intergenic
926018495 2:9474688-9474710 CTGCGGGGTCGCTGCCGAGCAGG + Intronic
927558030 2:24049733-24049755 CCTCGCCGCCACTGCAGAGCCGG - Exonic
927812168 2:26186254-26186276 CCGGGGGGCTGCTGGAGAGCCGG - Exonic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
931670834 2:64645256-64645278 CCGCGCGGCCGGTGCGCAGCGGG - Intronic
932121332 2:69103217-69103239 CCGGAGGGCTGCTGCAGGGCTGG - Intronic
932314067 2:70768054-70768076 CCGCGGAGCCGCTGCACTGCTGG - Exonic
936079734 2:109423994-109424016 CGTCTGGGCCGCTGCAGGGCCGG + Intronic
937853359 2:126655775-126655797 CTGCGCGGCCGCTGGATAGCTGG - Intergenic
938208564 2:129444556-129444578 CCCAGGGGCAGCTGCGGAGCTGG + Intergenic
938727286 2:134120129-134120151 CCGCAGGGCCGCCGCCGAGCGGG - Intronic
941164891 2:162074158-162074180 CCGCGGGCAGGCTGCAGGGCAGG + Exonic
942093298 2:172514593-172514615 CCGTGGGCCACCTGCAGAGCTGG - Intergenic
942138749 2:172956090-172956112 CCTCGGGGCCACTGCTGAGAGGG - Intronic
945486176 2:210398701-210398723 TCTCAGGGCCGCTGCAGAGACGG - Intergenic
948206649 2:236166246-236166268 CCGCGGCGCCGCTGCTCGGCGGG + Exonic
948459715 2:238123353-238123375 CAGCCGGGCTGCCGCAGAGCCGG - Intronic
948945024 2:241215075-241215097 CCACAGGGCAGCTGCAGGGCGGG - Intronic
948983876 2:241508474-241508496 CTTCGCGGGCGCTGCAGAGCGGG - Exonic
948994594 2:241572017-241572039 CCGGAGGGCCCCTGCCGAGCAGG - Intronic
1171420090 20:25012188-25012210 ACGCGTGGCGGCTGCAGAGCTGG + Intronic
1171986380 20:31664397-31664419 AGGAGGGGCCGCTGGAGAGCTGG - Intergenic
1172997700 20:39083340-39083362 CCACAGGGACCCTGCAGAGCAGG + Intergenic
1173251496 20:41366343-41366365 CCCCGAGGCCGCTGCACAGAGGG - Intronic
1173726377 20:45301137-45301159 CCACGGTGCCACTGCAGAGAGGG - Exonic
1174399373 20:50267699-50267721 GGGCGGGGCGGCTGCTGAGCAGG + Intergenic
1175955513 20:62607017-62607039 CCACGGGGCTGCTGCAGAGGCGG + Intergenic
1178561541 21:33643015-33643037 CCGCGGCCCCGCCGCCGAGCGGG + Intronic
1180891357 22:19291492-19291514 CCGCTGAGCCGCTGCCCAGCTGG - Intronic
1181512629 22:23395666-23395688 CAGCGGGGCCCAGGCAGAGCTGG + Intergenic
1183437095 22:37802590-37802612 CCTCAGGGACACTGCAGAGCTGG - Intergenic
1184097992 22:42326889-42326911 GTGAGTGGCCGCTGCAGAGCAGG - Intronic
1184125529 22:42484035-42484057 CCGCTCGGCCCCTGCAGAGCCGG - Intergenic
1184134013 22:42535533-42535555 CCGCTCGGCCCCTGCAGAGCCGG - Intergenic
1184163954 22:42716557-42716579 CTGCTGGGCAGCGGCAGAGCGGG + Intronic
1184748690 22:46472052-46472074 CCGCGGAGCCGCTCCAGGCCTGG - Intronic
1185055085 22:48575306-48575328 AGGCGGGGGCGCTGCAGGGCGGG + Intronic
950773589 3:15331915-15331937 CCGCGGTGCCGCGGCCGGGCAGG + Intronic
954035686 3:47849797-47849819 CGGAGGAGCAGCTGCAGAGCGGG - Intronic
963827433 3:149970647-149970669 CCGCGGGGGCACCGCAGCGCGGG - Intronic
968434011 4:575837-575859 CCCGGGGTCCGCAGCAGAGCAGG + Intergenic
969349845 4:6592035-6592057 CCACGTGGAGGCTGCAGAGCTGG - Intronic
972715771 4:41644538-41644560 CCGCGGTGCAGCCGCACAGCAGG + Exonic
977536435 4:98260910-98260932 AGGCTGGGCCGCCGCAGAGCCGG - Intergenic
982068036 4:151671899-151671921 CCTTGGAGACGCTGCAGAGCAGG - Intronic
982198387 4:152937284-152937306 GCGCGCGGCCGCCGCAGACCCGG + Intronic
982729051 4:158935888-158935910 CGCCGGGGCTGCTGCTGAGCTGG + Intronic
985518911 5:361550-361572 GAGTGGGGCCACTGCAGAGCTGG + Intronic
985580591 5:693549-693571 CCGCGGGGCCTGAGCAGAGTCGG - Intergenic
986304729 5:6506764-6506786 ACACGGGGCCGCCGCAGAGGCGG - Intergenic
992106199 5:73451033-73451055 CAGAGGGACCGCTGCAGAGACGG + Intergenic
993901731 5:93588529-93588551 CCGCGCGGCCGGTGCGGGGCGGG + Intronic
994083317 5:95731529-95731551 CGGCGGGGCCGACGCAGAGCGGG - Exonic
998149179 5:139747319-139747341 GGGCGGGGCTGCAGCAGAGCGGG + Intergenic
999765885 5:154740592-154740614 CAGCAAGTCCGCTGCAGAGCTGG + Intronic
1001700803 5:173705409-173705431 CCGTGGGGCCGCTGGAGAAGGGG + Intergenic
1003114365 6:3273494-3273516 CAGCAGGGCCCCTGCAGAGGTGG - Intronic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1004273032 6:14211804-14211826 CCTGGGGACAGCTGCAGAGCAGG - Intergenic
1007465506 6:42048701-42048723 CCGCGCCGCCGATCCAGAGCTGG + Intronic
1007484989 6:42174838-42174860 CCGCGTGTCCTCTGCAGACCCGG + Intronic
1011633915 6:89352882-89352904 CCGGGCGGCCGCGGCAGGGCTGG - Intergenic
1012405060 6:98886683-98886705 CCGCAGTGCCACTGCAGAGCAGG - Intronic
1013242805 6:108261292-108261314 CCGCGGGGCTGCGGCCGAGGAGG + Intergenic
1014755893 6:125301810-125301832 CCGGGAGGCCGCGGCCGAGCGGG - Intronic
1018399214 6:163405482-163405504 CTCCGAGGCAGCTGCAGAGCAGG - Intergenic
1019073689 6:169370144-169370166 CAGCGGGCCCCCTGCAGGGCTGG + Intergenic
1019143389 6:169962111-169962133 CACCGGGGCGGCCGCAGAGCAGG + Intergenic
1019196899 6:170288401-170288423 CCGTGCGGCCGCTGCTGTGCAGG + Exonic
1019379226 7:712497-712519 GGGCGGCGCCGCTGCAGTGCGGG - Intronic
1019429226 7:991036-991058 CCGAGGGTCCCCTGCAGGGCCGG - Intergenic
1019612736 7:1945140-1945162 CTGCTGGGCCCCTGCTGAGCGGG - Intronic
1019891292 7:3949150-3949172 TCGAGGGTCCGCTGCAGAGTTGG + Intronic
1020281945 7:6654407-6654429 CCGCGGAGCCACCGCAGCGCCGG + Exonic
1020756604 7:12211292-12211314 GCGCGCGGCCGCCGTAGAGCTGG - Exonic
1024520906 7:50303904-50303926 CCGCAGCGCCGCGGCCGAGCCGG + Intergenic
1026471059 7:70694419-70694441 CCGCGGCGCGGCTGGAGAGGCGG + Intronic
1027250021 7:76393233-76393255 CCGCCGCGCAGCCGCAGAGCGGG + Intronic
1028391399 7:90321268-90321290 CCGCGTGGCCGCAGCAGAACCGG - Intergenic
1031483180 7:122302018-122302040 CCCCGGGGCCCCTGCAGCCCGGG - Exonic
1033477165 7:141702115-141702137 ACGCGGCGCCGCTGCTGCGCTGG - Exonic
1034268777 7:149793442-149793464 CCTGGGGGCAGCTGCCGAGCGGG - Intergenic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034891825 7:154846438-154846460 CAGCCGGGCTGCTGCAGACCTGG + Intronic
1035634125 8:1130797-1130819 CAGCCCAGCCGCTGCAGAGCTGG - Intergenic
1035719430 8:1780583-1780605 CTCCGGGGCGGCAGCAGAGCTGG + Exonic
1037833197 8:22201126-22201148 CCCCGAGGGGGCTGCAGAGCTGG - Intronic
1038326578 8:26577197-26577219 CCGGGGGGAGGCTGCAGAGACGG - Intronic
1039542507 8:38382989-38383011 CCTCCGGGCCGCAGCAGAGCAGG - Intergenic
1045215646 8:100145885-100145907 GGGCGGGAGCGCTGCAGAGCCGG - Intergenic
1045327880 8:101130108-101130130 CTGCAGGTCCTCTGCAGAGCAGG - Intergenic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049578142 8:143398902-143398924 CCCCAGGGCAGCTGCAGTGCCGG - Intergenic
1049681554 8:143920851-143920873 CCGCCGAGCTGCTGGAGAGCAGG - Exonic
1050343321 9:4662501-4662523 CCGTGGCGCGGCTGCTGAGCAGG - Exonic
1050345218 9:4679606-4679628 CCGCGACGCCGCTGCACACCCGG - Exonic
1050388144 9:5111655-5111677 CCACAGGGCCGCTGCTGGGCGGG - Intronic
1057337434 9:94166612-94166634 CCGCGTGGCCGCCGCGGGGCCGG + Intergenic
1057489576 9:95510885-95510907 CCGCGCGGCCGGGGCAGAGTAGG + Intronic
1059145548 9:111896680-111896702 CCGCGCGCCCGCTGCGGCGCCGG - Intergenic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059354491 9:113688130-113688152 CCGCGGGAACCCTGGAGAGCCGG + Intergenic
1061036635 9:128118029-128118051 CCCCGGGGCTGCTGCAGATGGGG - Intergenic
1061296426 9:129679298-129679320 CCGGGGTGCTGCTGCAGAGTCGG + Intronic
1062290375 9:135791725-135791747 CCTCTGGGCCCCTGCAGAGCTGG + Intronic
1062462115 9:136666362-136666384 CTGCGGGGCTGCTGCCGGGCAGG + Intronic
1062564809 9:137159463-137159485 CACAGGGGCCGGTGCAGAGCAGG - Intronic
1203773877 EBV:62264-62286 CCCCTGGGCGGCTGCAGGGCAGG - Intergenic
1185468639 X:369847-369869 AGTGGGGGCCGCTGCAGAGCGGG - Intronic
1187419559 X:19122573-19122595 GCGCTGGGCAGCTGGAGAGCTGG - Intronic
1189407161 X:40735521-40735543 CCGCCGGGCCGCCTCAGAACAGG + Exonic
1200177192 X:154125481-154125503 CCACGAGGCTGCTGCGGAGCGGG - Intergenic