ID: 1096791393

View in Genome Browser
Species Human (GRCh38)
Location 12:54047350-54047372
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096791388_1096791393 -8 Left 1096791388 12:54047335-54047357 CCTGAGAGTCCCGCGCCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG 0: 1
1: 0
2: 2
3: 21
4: 246
1096791385_1096791393 -2 Left 1096791385 12:54047329-54047351 CCACAGCCTGAGAGTCCCGCGCC 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG 0: 1
1: 0
2: 2
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type