ID: 1096792109

View in Genome Browser
Species Human (GRCh38)
Location 12:54051808-54051830
Sequence GCACCCTTTGGGCACGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096792103_1096792109 -8 Left 1096792103 12:54051793-54051815 CCCAGGCGGGAATCCGCACCCTT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 134
1096792104_1096792109 -9 Left 1096792104 12:54051794-54051816 CCAGGCGGGAATCCGCACCCTTT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 134
1096792096_1096792109 24 Left 1096792096 12:54051761-54051783 CCTAAGCATTGGAGGAGGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 247
Right 1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096792109 Original CRISPR GCACCCTTTGGGCACGGCTG TGG Intronic
901701543 1:11047115-11047137 GCAGCCTATGGGCAGGGCAGGGG + Exonic
901809900 1:11761752-11761774 GCACCTATTGGGAACGGGTGAGG + Intergenic
902559657 1:17269479-17269501 GCACCCATGGGGCACGGTTCTGG - Intronic
904292770 1:29498345-29498367 GCACCCTTTGGGGGCAGATGAGG + Intergenic
904963641 1:34354790-34354812 GCTCCCTGTGGGAACTGCTGAGG + Intergenic
905912297 1:41662847-41662869 GCACACTTTGGGGACGGCGATGG - Intronic
906249094 1:44297476-44297498 CCACCCTATTGGCATGGCTGGGG + Intronic
910457412 1:87412362-87412384 GCTCCCTTTGGGATCTGCTGAGG - Intergenic
910569453 1:88684059-88684081 GCAGCCATTGGACTCGGCTGGGG - Intergenic
911664816 1:100540057-100540079 GGACACTGCGGGCACGGCTGTGG - Exonic
913193587 1:116433887-116433909 GCACCCCAAGGGCAGGGCTGGGG - Intergenic
915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG + Intronic
917317642 1:173742215-173742237 ACACCCTGTTGGCAAGGCTGTGG + Intronic
920301103 1:204989587-204989609 ACACCCTCTGGGAAAGGCTGGGG + Intronic
920715776 1:208338651-208338673 GCATCCTTTAAGCATGGCTGTGG + Intergenic
923561869 1:235047716-235047738 GCATCCTTTGGGTCTGGCTGTGG - Intergenic
924123151 1:240823394-240823416 GCACCACTTGGGCCCGGCAGAGG + Intronic
1063209067 10:3862277-3862299 GCACCCTTTTGTCACTTCTGAGG + Intergenic
1068519745 10:58065114-58065136 GGAACCTGTGGGCACAGCTGAGG - Intergenic
1069076380 10:64042094-64042116 GCACCCACAGTGCACGGCTGGGG + Intergenic
1070095076 10:73329320-73329342 TCACACTTTGGGGACGGTTGTGG + Intronic
1070689835 10:78516384-78516406 CCACCCCTTGGGCAGAGCTGTGG + Intergenic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1076373408 10:129968642-129968664 GCTCCCTTTGTGCGCGACTGAGG - Intergenic
1076519293 10:131070729-131070751 GCACTCCATGGGCAAGGCTGGGG + Intergenic
1076561114 10:131364892-131364914 GCTCCCTTTGGACACAGGTGGGG + Intergenic
1077100239 11:819359-819381 GCCCCTGCTGGGCACGGCTGGGG - Intronic
1077187862 11:1243489-1243511 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077188283 11:1245160-1245182 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077188818 11:1247260-1247282 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077189237 11:1248931-1248953 GCACCGTGTGGGGACTGCTGGGG - Exonic
1077441286 11:2570326-2570348 GCCCCCTCTGGCCAAGGCTGGGG + Intronic
1077464894 11:2729081-2729103 GCGCCCTTTGTGCCCGCCTGGGG - Intronic
1078508543 11:11968955-11968977 GCTCTCTGTGGGCAGGGCTGTGG - Intronic
1081600790 11:44492285-44492307 GCTCCCTGTGGGCTGGGCTGAGG + Intergenic
1081869282 11:46376006-46376028 GGCCCCCTTGGGCAGGGCTGTGG + Intronic
1085123747 11:73983430-73983452 ACAGCCGTTGGGCTCGGCTGGGG + Intergenic
1085215542 11:74827271-74827293 GCCCCTTTTAGCCACGGCTGGGG + Intronic
1089681080 11:120119331-120119353 GCAGCCTGTGGGGAGGGCTGGGG + Intronic
1091319483 11:134639805-134639827 GCACCCTTCTGTCACTGCTGGGG - Intergenic
1096242690 12:49967737-49967759 GCAGCCCTCGGGCACGACTGAGG - Intronic
1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG + Intronic
1100390044 12:94140082-94140104 GCACCGTCTTGGCCCGGCTGTGG - Intergenic
1104517699 12:129443081-129443103 GCTCCCCTTGGGGTCGGCTGAGG + Intronic
1104589641 12:130074130-130074152 GAGCCCTATGGGCACTGCTGAGG + Intergenic
1104976917 12:132556280-132556302 GCACTCTCTGAGCAAGGCTGTGG - Intronic
1106283910 13:28302602-28302624 GCACCATGTGGGCACGGAGGGGG - Exonic
1112369030 13:98778640-98778662 CCACCCTCTGGACATGGCTGAGG - Intergenic
1116678662 14:47938615-47938637 GCACTCTTTGCTGACGGCTGTGG + Intergenic
1122705289 14:103617052-103617074 GCACCTTGTGGGCGGGGCTGTGG + Intronic
1122841606 14:104467212-104467234 GGTCCCTTTGGGAAAGGCTGGGG + Intergenic
1125444312 15:39736980-39737002 GCACCCTTAGCACAGGGCTGGGG + Intronic
1128471910 15:67961645-67961667 GCAGCCTTTGCCCAGGGCTGTGG + Intergenic
1129225615 15:74168746-74168768 CTACCCTTTGGGAAGGGCTGGGG + Intergenic
1133820039 16:9227821-9227843 GCACCATGTGGCCACTGCTGGGG - Intergenic
1134047685 16:11113115-11113137 GCACCCTTGGGACATAGCTGTGG - Intronic
1135677404 16:24428481-24428503 TCACACTTTGGGCAGGGGTGGGG + Intergenic
1137801938 16:51269514-51269536 GCACCCATTGGGAAGGGCTGAGG + Intergenic
1138078770 16:54068747-54068769 CCTCCCTTTGTGCATGGCTGTGG + Intronic
1142190843 16:88716617-88716639 GCTTCATCTGGGCACGGCTGGGG + Exonic
1144755609 17:17678935-17678957 GGACCCTGTAGGCAGGGCTGGGG - Intergenic
1145306998 17:21680915-21680937 GCACCATCTGGGCAGGCCTGAGG + Intergenic
1145307911 17:21685575-21685597 GCACCGTCTGGGCAGGCCTGAGG + Intergenic
1146141846 17:30374926-30374948 GAACCATTTGGGCAAGGCTAAGG - Intergenic
1146143380 17:30388698-30388720 GCTCCCAGGGGGCACGGCTGGGG - Intronic
1148478299 17:47943424-47943446 GCACCAGGTGGGCATGGCTGTGG + Exonic
1150209946 17:63436393-63436415 GCCCTCTTTGTGCACAGCTGGGG - Intronic
1152202041 17:78952827-78952849 GCTCCCTTTGGGCTCGGGGGTGG - Intergenic
1154227160 18:12515836-12515858 GCTCCCTGTGGGATCGGCTGAGG + Intronic
1155850717 18:30770285-30770307 GCACCCTTTGCTGATGGCTGTGG + Intergenic
1160386260 18:78498772-78498794 GCACCGTCTCGGCACTGCTGGGG - Intergenic
1160657188 19:279583-279605 GGACCCTCTGGGGATGGCTGTGG + Intergenic
1161333629 19:3699783-3699805 GCACCCTGTGTGCACAGCCGGGG + Intronic
1161659924 19:5539729-5539751 ACACTCACTGGGCACGGCTGTGG + Intergenic
1162562308 19:11423812-11423834 GCACCCCTGGGGCCCGTCTGGGG + Intronic
1162968620 19:14167373-14167395 GCACCCTTGGTGCAAGGCGGGGG + Intronic
1164086721 19:21909308-21909330 GCCCCCTCCGGGCAGGGCTGAGG - Intergenic
1164119860 19:22256457-22256479 GCTCCCTTTGGGCAAGGTTCAGG + Intergenic
1164181346 19:22821564-22821586 CCACTCTGTGGGCAGGGCTGTGG - Intergenic
1164844772 19:31422534-31422556 GCACCCTTTGGGGATGACAGTGG - Intergenic
1166071126 19:40388693-40388715 GCACCCTGAGGGCAAGGCTGGGG - Intronic
1166317685 19:41998183-41998205 GCAGCCTGTAGGCAGGGCTGAGG + Intergenic
1168404119 19:56102029-56102051 GCTCCCTGTGGGCGGGGCTGTGG - Intronic
925113123 2:1353161-1353183 GCAGCCTTTGCTCACTGCTGAGG - Intronic
928437699 2:31266354-31266376 GGCCCCTTTGGGCATGGCTATGG + Exonic
930899225 2:56483252-56483274 GTAGCCTTTGTGCAAGGCTGTGG - Intergenic
935170009 2:100603560-100603582 GCACCCCTTGCGCATGGCTCTGG + Intergenic
936522285 2:113218951-113218973 GCACTGTTTGGGCAAGGCTAGGG - Intronic
936898692 2:117459262-117459284 TCACACTTTGGGGACTGCTGTGG - Intergenic
948449659 2:238061148-238061170 GCGCCTTTAGGGCAGGGCTGGGG + Intronic
1170430387 20:16270391-16270413 GCACCCTTGGGGAGCAGCTGTGG - Intergenic
1175199301 20:57266745-57266767 GAACCCACTGGGCACAGCTGGGG - Intergenic
1179613782 21:42568948-42568970 GCAGCCTGACGGCACGGCTGTGG + Intronic
1180959524 22:19756322-19756344 ACTCCCTTGGGGCAGGGCTGAGG + Intergenic
1183489666 22:38109668-38109690 GCCCCCCATGGGCAAGGCTGTGG + Intronic
1184203368 22:42984701-42984723 GCAGCCTTTTGGCACAGGTGAGG - Intronic
950150178 3:10680756-10680778 GCACCCTTAGGACATGTCTGAGG + Intronic
950189919 3:10969579-10969601 GCCCCATATGGGCAGGGCTGAGG - Intergenic
951430132 3:22597176-22597198 GCTCCTTTTAGGCATGGCTGGGG - Intergenic
955973332 3:64457805-64457827 GCAGCCTTTGGAAACTGCTGTGG - Intergenic
956724500 3:72145935-72145957 CCACCCAGTGGGCAGGGCTGAGG + Intergenic
959785706 3:110295009-110295031 GTACCTTTTAGGCATGGCTGAGG + Intergenic
961448931 3:126993663-126993685 GCACCCTTTGGGAGCATCTGGGG + Intronic
963973166 3:151451452-151451474 GCATCCATTGGCCAGGGCTGGGG - Intronic
968963454 4:3757533-3757555 GTAACCTTTGGCCACAGCTGGGG + Intergenic
969302101 4:6303137-6303159 GAACCCTGTGGGGGCGGCTGTGG + Exonic
969643049 4:8410713-8410735 GTGCCCTGTGGGCAGGGCTGTGG + Intronic
984888509 4:184472787-184472809 GGACCCTTGGCGCTCGGCTGCGG - Intronic
985075073 4:186206034-186206056 TCACCATGTGGGCAGGGCTGTGG + Intronic
985085498 4:186308737-186308759 GCACCCTTTGGGGTTGGCTGGGG - Intergenic
985996126 5:3597966-3597988 GCACCCTTTGTGGAGAGCTGGGG + Intronic
986324304 5:6660377-6660399 ACAGCCTGTGGGCAGGGCTGGGG - Intronic
986534523 5:8773272-8773294 GCATCCTTTGGGGAGGTCTGTGG - Intergenic
988362658 5:30255661-30255683 GCCCCCTTTAGCCATGGCTGGGG + Intergenic
993729454 5:91405094-91405116 GCACTCTATTGGCAAGGCTGTGG - Intergenic
994087283 5:95773233-95773255 TCACCCTTTATGCAGGGCTGGGG + Intronic
997380927 5:133437333-133437355 TCAACCTTTGGGCATGGTTGAGG + Intronic
998427307 5:142039757-142039779 GCACCCTGTGTACAGGGCTGGGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1004919862 6:20366509-20366531 GCACCCTCTGGGCATGGCAGGGG - Intergenic
1007142803 6:39592837-39592859 GCACCCTTTGAGCAGGTGTGAGG + Intronic
1007704851 6:43784343-43784365 GCTCCCTGAGGGCAGGGCTGGGG + Intronic
1008180194 6:48318782-48318804 GCATCCTATGTGCATGGCTGGGG - Intergenic
1014671181 6:124305653-124305675 CCACCCTTTTGCCACGACTGTGG - Intronic
1018937678 6:168284239-168284261 TCACCCGAGGGGCACGGCTGGGG + Intergenic
1020092916 7:5351413-5351435 GCTCTCTTTGGGCACGGGTTCGG - Intronic
1022505408 7:30906280-30906302 TCACCCTCAGGGCAGGGCTGGGG + Intergenic
1029547440 7:101217653-101217675 GCACTCTCTGGGCAGGGCTGCGG - Exonic
1030129338 7:106184046-106184068 GCAGCCTTTGTGCAAGGTTGTGG + Intergenic
1032255967 7:130297416-130297438 GCACCCTGTGGGCACTGCCGAGG - Intronic
1032498562 7:132381754-132381776 GCAGCCTTTGCCCAGGGCTGAGG + Intronic
1033599947 7:142882153-142882175 GTACCCTCTGGGCAGGGCTGGGG + Intronic
1036709803 8:11070997-11071019 GCACACAGTGGGTACGGCTGTGG + Intronic
1037834579 8:22208564-22208586 GCACACTCTGGGCTGGGCTGGGG - Intronic
1039805733 8:40996155-40996177 GCACTCCTTTGGCAAGGCTGTGG - Intergenic
1049714292 8:144082661-144082683 GCAGCCTGTGGGCACCGCGGCGG + Exonic
1051172488 9:14332584-14332606 GCACCTTTTGGACACTGCTCCGG - Intronic
1055758829 9:79584342-79584364 ACTCCCTTTGGGCAGGGCAGAGG - Intronic
1057553154 9:96066843-96066865 GCCCCCTTTGGGGACAGCTGAGG + Intergenic
1058450042 9:105088013-105088035 GCAGCCTTTGGGCAAGGATATGG + Intergenic
1186909144 X:14143100-14143122 GCACCCTTTGGCCAATGTTGAGG + Intergenic
1189725176 X:43961169-43961191 GCACCCTATTGGCAAGGCTGTGG + Intronic
1192393001 X:70750751-70750773 TCACACTCTGGGCACTGCTGTGG + Intronic
1195944564 X:110195059-110195081 GCAGCATTTGGGCATGGCTGGGG + Exonic
1198962298 X:142195515-142195537 GCATCCTTTGAGCAGGGATGGGG + Intergenic
1200232839 X:154453009-154453031 GCACTGTGTGGGCAAGGCTGGGG - Intergenic