ID: 1096795065

View in Genome Browser
Species Human (GRCh38)
Location 12:54071601-54071623
Sequence AGGCAGAAACAAGATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096795061_1096795065 -10 Left 1096795061 12:54071588-54071610 CCTGAGGGAAGAGAGGCAGAAAC No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data
1096795056_1096795065 -3 Left 1096795056 12:54071581-54071603 CCCTGCCCCTGAGGGAAGAGAGG No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data
1096795052_1096795065 7 Left 1096795052 12:54071571-54071593 CCCTTAAGGACCCTGCCCCTGAG No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data
1096795060_1096795065 -9 Left 1096795060 12:54071587-54071609 CCCTGAGGGAAGAGAGGCAGAAA No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data
1096795058_1096795065 -4 Left 1096795058 12:54071582-54071604 CCTGCCCCTGAGGGAAGAGAGGC No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data
1096795059_1096795065 -8 Left 1096795059 12:54071586-54071608 CCCCTGAGGGAAGAGAGGCAGAA No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data
1096795053_1096795065 6 Left 1096795053 12:54071572-54071594 CCTTAAGGACCCTGCCCCTGAGG No data
Right 1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096795065 Original CRISPR AGGCAGAAACAAGATGGGGC AGG Intergenic
No off target data available for this crispr