ID: 1096796095

View in Genome Browser
Species Human (GRCh38)
Location 12:54078436-54078458
Sequence TCTCCTAGCTGGTTTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096796087_1096796095 28 Left 1096796087 12:54078385-54078407 CCTGAGCTCTATTTACCCTTTTG No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796090_1096796095 0 Left 1096796090 12:54078413-54078435 CCATCCCTCCATAAGTACACAAC No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796091_1096796095 -4 Left 1096796091 12:54078417-54078439 CCCTCCATAAGTACACAACTCTC No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796088_1096796095 13 Left 1096796088 12:54078400-54078422 CCCTTTTGTAACTCCATCCCTCC No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796086_1096796095 29 Left 1096796086 12:54078384-54078406 CCCTGAGCTCTATTTACCCTTTT No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796092_1096796095 -5 Left 1096796092 12:54078418-54078440 CCTCCATAAGTACACAACTCTCC No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796089_1096796095 12 Left 1096796089 12:54078401-54078423 CCTTTTGTAACTCCATCCCTCCA No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data
1096796093_1096796095 -8 Left 1096796093 12:54078421-54078443 CCATAAGTACACAACTCTCCTAG No data
Right 1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096796095 Original CRISPR TCTCCTAGCTGGTTTCCTAG AGG Intergenic
No off target data available for this crispr