ID: 1096797469

View in Genome Browser
Species Human (GRCh38)
Location 12:54086861-54086883
Sequence TATCCCTCCCTCTCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096797469_1096797473 19 Left 1096797469 12:54086861-54086883 CCAGCACCAGAGAGGGAGGGATA No data
Right 1096797473 12:54086903-54086925 GATAAGCAGGGCCCATTTACCGG No data
1096797469_1096797474 20 Left 1096797469 12:54086861-54086883 CCAGCACCAGAGAGGGAGGGATA No data
Right 1096797474 12:54086904-54086926 ATAAGCAGGGCCCATTTACCGGG No data
1096797469_1096797471 6 Left 1096797469 12:54086861-54086883 CCAGCACCAGAGAGGGAGGGATA No data
Right 1096797471 12:54086890-54086912 ACACAGTCTTGCAGATAAGCAGG No data
1096797469_1096797472 7 Left 1096797469 12:54086861-54086883 CCAGCACCAGAGAGGGAGGGATA No data
Right 1096797472 12:54086891-54086913 CACAGTCTTGCAGATAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096797469 Original CRISPR TATCCCTCCCTCTCTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr