ID: 1096797472

View in Genome Browser
Species Human (GRCh38)
Location 12:54086891-54086913
Sequence CACAGTCTTGCAGATAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096797467_1096797472 10 Left 1096797467 12:54086858-54086880 CCTCCAGCACCAGAGAGGGAGGG No data
Right 1096797472 12:54086891-54086913 CACAGTCTTGCAGATAAGCAGGG No data
1096797465_1096797472 13 Left 1096797465 12:54086855-54086877 CCTCCTCCAGCACCAGAGAGGGA No data
Right 1096797472 12:54086891-54086913 CACAGTCTTGCAGATAAGCAGGG No data
1096797470_1096797472 1 Left 1096797470 12:54086867-54086889 CCAGAGAGGGAGGGATAAAAATT No data
Right 1096797472 12:54086891-54086913 CACAGTCTTGCAGATAAGCAGGG No data
1096797469_1096797472 7 Left 1096797469 12:54086861-54086883 CCAGCACCAGAGAGGGAGGGATA No data
Right 1096797472 12:54086891-54086913 CACAGTCTTGCAGATAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096797472 Original CRISPR CACAGTCTTGCAGATAAGCA GGG Intergenic
No off target data available for this crispr