ID: 1096797554

View in Genome Browser
Species Human (GRCh38)
Location 12:54087405-54087427
Sequence CTGGCTACACATTAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096797554_1096797561 19 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797561 12:54087447-54087469 AGGAAATGATACAAGAGATAAGG No data
1096797554_1096797564 24 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797564 12:54087452-54087474 ATGATACAAGAGATAAGGGGAGG No data
1096797554_1096797556 -8 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797556 12:54087420-54087442 GTAGCCAGAGGTTGAGATGCAGG No data
1096797554_1096797565 25 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797565 12:54087453-54087475 TGATACAAGAGATAAGGGGAGGG No data
1096797554_1096797558 -1 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797558 12:54087427-54087449 GAGGTTGAGATGCAGGCCCTAGG No data
1096797554_1096797563 21 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797563 12:54087449-54087471 GAAATGATACAAGAGATAAGGGG No data
1096797554_1096797562 20 Left 1096797554 12:54087405-54087427 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1096797562 12:54087448-54087470 GGAAATGATACAAGAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096797554 Original CRISPR CTGGCTACACATTAGCAACC TGG (reversed) Intergenic
No off target data available for this crispr