ID: 1096799053

View in Genome Browser
Species Human (GRCh38)
Location 12:54097282-54097304
Sequence GCTTTCTCTGGAACTCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799053_1096799061 16 Left 1096799053 12:54097282-54097304 CCTAGGTGAGTTCCAGAGAAAGC No data
Right 1096799061 12:54097321-54097343 GAGCCAGTCAGAAGGGATCAGGG No data
1096799053_1096799059 9 Left 1096799053 12:54097282-54097304 CCTAGGTGAGTTCCAGAGAAAGC No data
Right 1096799059 12:54097314-54097336 AGACTATGAGCCAGTCAGAAGGG No data
1096799053_1096799058 8 Left 1096799053 12:54097282-54097304 CCTAGGTGAGTTCCAGAGAAAGC No data
Right 1096799058 12:54097313-54097335 AAGACTATGAGCCAGTCAGAAGG No data
1096799053_1096799060 15 Left 1096799053 12:54097282-54097304 CCTAGGTGAGTTCCAGAGAAAGC No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799053 Original CRISPR GCTTTCTCTGGAACTCACCT AGG (reversed) Intergenic
No off target data available for this crispr