ID: 1096799055

View in Genome Browser
Species Human (GRCh38)
Location 12:54097294-54097316
Sequence TCTTTCACCTGGGCTTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799055_1096799060 3 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799055_1096799065 25 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799065 12:54097342-54097364 GGTAGAACCCAAGTTGGGACAGG No data
1096799055_1096799059 -3 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799059 12:54097314-54097336 AGACTATGAGCCAGTCAGAAGGG No data
1096799055_1096799058 -4 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799058 12:54097313-54097335 AAGACTATGAGCCAGTCAGAAGG No data
1096799055_1096799066 29 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG No data
1096799055_1096799064 20 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799064 12:54097337-54097359 ATCAGGGTAGAACCCAAGTTGGG No data
1096799055_1096799063 19 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799063 12:54097336-54097358 GATCAGGGTAGAACCCAAGTTGG No data
1096799055_1096799067 30 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799067 12:54097347-54097369 AACCCAAGTTGGGACAGGCAGGG No data
1096799055_1096799061 4 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799061 12:54097321-54097343 GAGCCAGTCAGAAGGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799055 Original CRISPR TCTTTCACCTGGGCTTTCTC TGG (reversed) Intergenic
No off target data available for this crispr