ID: 1096799056

View in Genome Browser
Species Human (GRCh38)
Location 12:54097304-54097326
Sequence TGGCTCATAGTCTTTCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799056_1096799067 20 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799067 12:54097347-54097369 AACCCAAGTTGGGACAGGCAGGG No data
1096799056_1096799065 15 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799065 12:54097342-54097364 GGTAGAACCCAAGTTGGGACAGG No data
1096799056_1096799064 10 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799064 12:54097337-54097359 ATCAGGGTAGAACCCAAGTTGGG No data
1096799056_1096799066 19 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG No data
1096799056_1096799061 -6 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799061 12:54097321-54097343 GAGCCAGTCAGAAGGGATCAGGG No data
1096799056_1096799071 24 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799071 12:54097351-54097373 CAAGTTGGGACAGGCAGGGGAGG No data
1096799056_1096799060 -7 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799056_1096799063 9 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799063 12:54097336-54097358 GATCAGGGTAGAACCCAAGTTGG No data
1096799056_1096799068 21 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799068 12:54097348-54097370 ACCCAAGTTGGGACAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799056 Original CRISPR TGGCTCATAGTCTTTCACCT GGG (reversed) Intergenic