ID: 1096799057

View in Genome Browser
Species Human (GRCh38)
Location 12:54097305-54097327
Sequence CTGGCTCATAGTCTTTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799057_1096799067 19 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799067 12:54097347-54097369 AACCCAAGTTGGGACAGGCAGGG No data
1096799057_1096799060 -8 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799057_1096799061 -7 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799061 12:54097321-54097343 GAGCCAGTCAGAAGGGATCAGGG No data
1096799057_1096799064 9 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799064 12:54097337-54097359 ATCAGGGTAGAACCCAAGTTGGG No data
1096799057_1096799071 23 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799071 12:54097351-54097373 CAAGTTGGGACAGGCAGGGGAGG No data
1096799057_1096799068 20 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799068 12:54097348-54097370 ACCCAAGTTGGGACAGGCAGGGG No data
1096799057_1096799065 14 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799065 12:54097342-54097364 GGTAGAACCCAAGTTGGGACAGG No data
1096799057_1096799066 18 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG No data
1096799057_1096799063 8 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799063 12:54097336-54097358 GATCAGGGTAGAACCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799057 Original CRISPR CTGGCTCATAGTCTTTCACC TGG (reversed) Intergenic
No off target data available for this crispr