ID: 1096799060

View in Genome Browser
Species Human (GRCh38)
Location 12:54097320-54097342
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799056_1096799060 -7 Left 1096799056 12:54097304-54097326 CCCAGGTGAAAGACTATGAGCCA No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799057_1096799060 -8 Left 1096799057 12:54097305-54097327 CCAGGTGAAAGACTATGAGCCAG No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799055_1096799060 3 Left 1096799055 12:54097294-54097316 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799053_1096799060 15 Left 1096799053 12:54097282-54097304 CCTAGGTGAGTTCCAGAGAAAGC No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data
1096799052_1096799060 30 Left 1096799052 12:54097267-54097289 CCACACTGGGGAACTCCTAGGTG No data
Right 1096799060 12:54097320-54097342 TGAGCCAGTCAGAAGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799060 Original CRISPR TGAGCCAGTCAGAAGGGATC AGG Intergenic
No off target data available for this crispr