ID: 1096799062

View in Genome Browser
Species Human (GRCh38)
Location 12:54097324-54097346
Sequence CTACCCTGATCCCTTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799062_1096799066 -1 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG No data
1096799062_1096799073 22 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799073 12:54097369-54097391 GGAGGCAGTCCCAGTCTTTAGGG No data
1096799062_1096799074 23 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799074 12:54097370-54097392 GAGGCAGTCCCAGTCTTTAGGGG No data
1096799062_1096799068 1 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799068 12:54097348-54097370 ACCCAAGTTGGGACAGGCAGGGG No data
1096799062_1096799072 21 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799072 12:54097368-54097390 GGGAGGCAGTCCCAGTCTTTAGG No data
1096799062_1096799071 4 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799071 12:54097351-54097373 CAAGTTGGGACAGGCAGGGGAGG No data
1096799062_1096799064 -10 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799064 12:54097337-54097359 ATCAGGGTAGAACCCAAGTTGGG No data
1096799062_1096799065 -5 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799065 12:54097342-54097364 GGTAGAACCCAAGTTGGGACAGG No data
1096799062_1096799067 0 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799067 12:54097347-54097369 AACCCAAGTTGGGACAGGCAGGG No data
1096799062_1096799075 24 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799075 12:54097371-54097393 AGGCAGTCCCAGTCTTTAGGGGG No data
1096799062_1096799076 25 Left 1096799062 12:54097324-54097346 CCAGTCAGAAGGGATCAGGGTAG No data
Right 1096799076 12:54097372-54097394 GGCAGTCCCAGTCTTTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799062 Original CRISPR CTACCCTGATCCCTTCTGAC TGG (reversed) Intergenic