ID: 1096799189

View in Genome Browser
Species Human (GRCh38)
Location 12:54098224-54098246
Sequence GCCCCAGGCATTATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799186_1096799189 -3 Left 1096799186 12:54098204-54098226 CCCTAACTCTGCTTCAACTTGCC No data
Right 1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG No data
1096799187_1096799189 -4 Left 1096799187 12:54098205-54098227 CCTAACTCTGCTTCAACTTGCCC No data
Right 1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG No data
1096799183_1096799189 29 Left 1096799183 12:54098172-54098194 CCAATCTGGCTCAGCAGAGGGAC No data
Right 1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG No data
1096799185_1096799189 7 Left 1096799185 12:54098194-54098216 CCTGGATCTTCCCTAACTCTGCT No data
Right 1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799189 Original CRISPR GCCCCAGGCATTATTTCCCC AGG Intergenic
No off target data available for this crispr