ID: 1096799205

View in Genome Browser
Species Human (GRCh38)
Location 12:54098263-54098285
Sequence GGCCTGGAGTTCCCTGCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096799205_1096799209 0 Left 1096799205 12:54098263-54098285 CCCGTTGCAGGGAACTCCAGGCC No data
Right 1096799209 12:54098286-54098308 TTCAACCAGCAGAACTATTTTGG No data
1096799205_1096799213 16 Left 1096799205 12:54098263-54098285 CCCGTTGCAGGGAACTCCAGGCC No data
Right 1096799213 12:54098302-54098324 ATTTTGGCGTACATTAAGGTGGG No data
1096799205_1096799212 15 Left 1096799205 12:54098263-54098285 CCCGTTGCAGGGAACTCCAGGCC No data
Right 1096799212 12:54098301-54098323 TATTTTGGCGTACATTAAGGTGG No data
1096799205_1096799211 12 Left 1096799205 12:54098263-54098285 CCCGTTGCAGGGAACTCCAGGCC No data
Right 1096799211 12:54098298-54098320 AACTATTTTGGCGTACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096799205 Original CRISPR GGCCTGGAGTTCCCTGCAAC GGG (reversed) Intergenic
No off target data available for this crispr