ID: 1096801867

View in Genome Browser
Species Human (GRCh38)
Location 12:54115718-54115740
Sequence GGCTGTGTCTGAAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096801861_1096801867 5 Left 1096801861 12:54115690-54115712 CCAGGCAGAGGGCAGCTTGAGGG No data
Right 1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG No data
1096801856_1096801867 28 Left 1096801856 12:54115667-54115689 CCAGCTCACAAGGAAGGTGGGAT No data
Right 1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096801867 Original CRISPR GGCTGTGTCTGAAGGGCAGC AGG Intergenic
No off target data available for this crispr