ID: 1096801867 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:54115718-54115740 |
Sequence | GGCTGTGTCTGAAGGGCAGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096801861_1096801867 | 5 | Left | 1096801861 | 12:54115690-54115712 | CCAGGCAGAGGGCAGCTTGAGGG | No data | ||
Right | 1096801867 | 12:54115718-54115740 | GGCTGTGTCTGAAGGGCAGCAGG | No data | ||||
1096801856_1096801867 | 28 | Left | 1096801856 | 12:54115667-54115689 | CCAGCTCACAAGGAAGGTGGGAT | No data | ||
Right | 1096801867 | 12:54115718-54115740 | GGCTGTGTCTGAAGGGCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096801867 | Original CRISPR | GGCTGTGTCTGAAGGGCAGC AGG | Intergenic | ||
No off target data available for this crispr |