ID: 1096802981

View in Genome Browser
Species Human (GRCh38)
Location 12:54123780-54123802
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096802981_1096802987 20 Left 1096802981 12:54123780-54123802 CCCCACAACTCCTGCTGAAACAG No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096802981 Original CRISPR CTGTTTCAGCAGGAGTTGTG GGG (reversed) Intergenic
No off target data available for this crispr