ID: 1096802987

View in Genome Browser
Species Human (GRCh38)
Location 12:54123823-54123845
Sequence CCATCAGACTTTCCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096802981_1096802987 20 Left 1096802981 12:54123780-54123802 CCCCACAACTCCTGCTGAAACAG No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802977_1096802987 28 Left 1096802977 12:54123772-54123794 CCACCCTCCCCCACAACTCCTGC No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802978_1096802987 25 Left 1096802978 12:54123775-54123797 CCCTCCCCCACAACTCCTGCTGA No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802982_1096802987 19 Left 1096802982 12:54123781-54123803 CCCACAACTCCTGCTGAAACAGA No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802980_1096802987 21 Left 1096802980 12:54123779-54123801 CCCCCACAACTCCTGCTGAAACA No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802976_1096802987 29 Left 1096802976 12:54123771-54123793 CCCACCCTCCCCCACAACTCCTG No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802983_1096802987 18 Left 1096802983 12:54123782-54123804 CCACAACTCCTGCTGAAACAGAT No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802979_1096802987 24 Left 1096802979 12:54123776-54123798 CCTCCCCCACAACTCCTGCTGAA No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data
1096802984_1096802987 10 Left 1096802984 12:54123790-54123812 CCTGCTGAAACAGATGAATTTCA No data
Right 1096802987 12:54123823-54123845 CCATCAGACTTTCCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096802987 Original CRISPR CCATCAGACTTTCCCCAAGC AGG Intergenic
No off target data available for this crispr