ID: 1096805468

View in Genome Browser
Species Human (GRCh38)
Location 12:54138481-54138503
Sequence CTTGATCACCAGGTATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096805468_1096805474 14 Left 1096805468 12:54138481-54138503 CCCAGAGATACCTGGTGATCAAG No data
Right 1096805474 12:54138518-54138540 CATTCAAGGATGAAAAACCTAGG No data
1096805468_1096805472 0 Left 1096805468 12:54138481-54138503 CCCAGAGATACCTGGTGATCAAG No data
Right 1096805472 12:54138504-54138526 TCAGCCTTAGGCAGCATTCAAGG No data
1096805468_1096805475 28 Left 1096805468 12:54138481-54138503 CCCAGAGATACCTGGTGATCAAG No data
Right 1096805475 12:54138532-54138554 AAACCTAGGTTTTGAAAACTAGG No data
1096805468_1096805476 29 Left 1096805468 12:54138481-54138503 CCCAGAGATACCTGGTGATCAAG No data
Right 1096805476 12:54138533-54138555 AACCTAGGTTTTGAAAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096805468 Original CRISPR CTTGATCACCAGGTATCTCT GGG (reversed) Intergenic
No off target data available for this crispr