ID: 1096807322

View in Genome Browser
Species Human (GRCh38)
Location 12:54148710-54148732
Sequence TATGGGTGGGCGAAGGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807322_1096807337 23 Left 1096807322 12:54148710-54148732 CCACACCCCTTCGCCCACCCATA No data
Right 1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG No data
1096807322_1096807329 -6 Left 1096807322 12:54148710-54148732 CCACACCCCTTCGCCCACCCATA No data
Right 1096807329 12:54148727-54148749 CCCATAGTCCCTCCAGTACCTGG No data
1096807322_1096807335 16 Left 1096807322 12:54148710-54148732 CCACACCCCTTCGCCCACCCATA No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807322 Original CRISPR TATGGGTGGGCGAAGGGGTG TGG (reversed) Intergenic
No off target data available for this crispr