ID: 1096807327

View in Genome Browser
Species Human (GRCh38)
Location 12:54148724-54148746
Sequence GGTACTGGAGGGACTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807327_1096807337 9 Left 1096807327 12:54148724-54148746 CCACCCATAGTCCCTCCAGTACC No data
Right 1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG No data
1096807327_1096807342 27 Left 1096807327 12:54148724-54148746 CCACCCATAGTCCCTCCAGTACC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807327_1096807335 2 Left 1096807327 12:54148724-54148746 CCACCCATAGTCCCTCCAGTACC No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807327 Original CRISPR GGTACTGGAGGGACTATGGG TGG (reversed) Intergenic
No off target data available for this crispr