ID: 1096807333

View in Genome Browser
Species Human (GRCh38)
Location 12:54148739-54148761
Sequence GGGAAGGAGTAGCCAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807333_1096807337 -6 Left 1096807333 12:54148739-54148761 CCAGTACCTGGCTACTCCTTCCC No data
Right 1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG No data
1096807333_1096807342 12 Left 1096807333 12:54148739-54148761 CCAGTACCTGGCTACTCCTTCCC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807333 Original CRISPR GGGAAGGAGTAGCCAGGTAC TGG (reversed) Intergenic
No off target data available for this crispr