ID: 1096807335

View in Genome Browser
Species Human (GRCh38)
Location 12:54148749-54148771
Sequence GCTACTCCTTCCCTCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807322_1096807335 16 Left 1096807322 12:54148710-54148732 CCACACCCCTTCGCCCACCCATA No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807324_1096807335 10 Left 1096807324 12:54148716-54148738 CCCTTCGCCCACCCATAGTCCCT No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807330_1096807335 -2 Left 1096807330 12:54148728-54148750 CCATAGTCCCTCCAGTACCTGGC No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807331_1096807335 -9 Left 1096807331 12:54148735-54148757 CCCTCCAGTACCTGGCTACTCCT No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807326_1096807335 3 Left 1096807326 12:54148723-54148745 CCCACCCATAGTCCCTCCAGTAC No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807327_1096807335 2 Left 1096807327 12:54148724-54148746 CCACCCATAGTCCCTCCAGTACC No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807323_1096807335 11 Left 1096807323 12:54148715-54148737 CCCCTTCGCCCACCCATAGTCCC No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807321_1096807335 28 Left 1096807321 12:54148698-54148720 CCTCTGGCTGTTCCACACCCCTT No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807325_1096807335 9 Left 1096807325 12:54148717-54148739 CCTTCGCCCACCCATAGTCCCTC No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807328_1096807335 -1 Left 1096807328 12:54148727-54148749 CCCATAGTCCCTCCAGTACCTGG No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data
1096807332_1096807335 -10 Left 1096807332 12:54148736-54148758 CCTCCAGTACCTGGCTACTCCTT No data
Right 1096807335 12:54148749-54148771 GCTACTCCTTCCCTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807335 Original CRISPR GCTACTCCTTCCCTCCACCT TGG Intergenic
No off target data available for this crispr