ID: 1096807336

View in Genome Browser
Species Human (GRCh38)
Location 12:54148755-54148777
Sequence CAGCAGCCAAGGTGGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807336_1096807342 -4 Left 1096807336 12:54148755-54148777 CCTTCCCTCCACCTTGGCTGCTG No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807336 Original CRISPR CAGCAGCCAAGGTGGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr