ID: 1096807339

View in Genome Browser
Species Human (GRCh38)
Location 12:54148760-54148782
Sequence AGAACCAGCAGCCAAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807339_1096807342 -9 Left 1096807339 12:54148760-54148782 CCTCCACCTTGGCTGCTGGTTCT No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807339 Original CRISPR AGAACCAGCAGCCAAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr