ID: 1096807342

View in Genome Browser
Species Human (GRCh38)
Location 12:54148774-54148796
Sequence GCTGGTTCTCTTCTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807330_1096807342 23 Left 1096807330 12:54148728-54148750 CCATAGTCCCTCCAGTACCTGGC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807332_1096807342 15 Left 1096807332 12:54148736-54148758 CCTCCAGTACCTGGCTACTCCTT No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807336_1096807342 -4 Left 1096807336 12:54148755-54148777 CCTTCCCTCCACCTTGGCTGCTG No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807328_1096807342 24 Left 1096807328 12:54148727-54148749 CCCATAGTCCCTCCAGTACCTGG No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807339_1096807342 -9 Left 1096807339 12:54148760-54148782 CCTCCACCTTGGCTGCTGGTTCT No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807331_1096807342 16 Left 1096807331 12:54148735-54148757 CCCTCCAGTACCTGGCTACTCCT No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807327_1096807342 27 Left 1096807327 12:54148724-54148746 CCACCCATAGTCCCTCCAGTACC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807338_1096807342 -8 Left 1096807338 12:54148759-54148781 CCCTCCACCTTGGCTGCTGGTTC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807333_1096807342 12 Left 1096807333 12:54148739-54148761 CCAGTACCTGGCTACTCCTTCCC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807334_1096807342 6 Left 1096807334 12:54148745-54148767 CCTGGCTACTCCTTCCCTCCACC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data
1096807326_1096807342 28 Left 1096807326 12:54148723-54148745 CCCACCCATAGTCCCTCCAGTAC No data
Right 1096807342 12:54148774-54148796 GCTGGTTCTCTTCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807342 Original CRISPR GCTGGTTCTCTTCTCTCCCC AGG Intergenic
No off target data available for this crispr