ID: 1096807789

View in Genome Browser
Species Human (GRCh38)
Location 12:54150947-54150969
Sequence TTCCCTCAGCACCTCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096807782_1096807789 12 Left 1096807782 12:54150912-54150934 CCAGGGACAATCTGGCTTGTCCT No data
Right 1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG No data
1096807780_1096807789 16 Left 1096807780 12:54150908-54150930 CCCTCCAGGGACAATCTGGCTTG No data
Right 1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG No data
1096807778_1096807789 21 Left 1096807778 12:54150903-54150925 CCTGACCCTCCAGGGACAATCTG No data
Right 1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG No data
1096807781_1096807789 15 Left 1096807781 12:54150909-54150931 CCTCCAGGGACAATCTGGCTTGT No data
Right 1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG No data
1096807777_1096807789 22 Left 1096807777 12:54150902-54150924 CCCTGACCCTCCAGGGACAATCT No data
Right 1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG No data
1096807783_1096807789 -8 Left 1096807783 12:54150932-54150954 CCTCCCCCAGACTTCTTCCCTCA No data
Right 1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096807789 Original CRISPR TTCCCTCAGCACCTCAGGTG AGG Intergenic
No off target data available for this crispr