ID: 1096808519

View in Genome Browser
Species Human (GRCh38)
Location 12:54155304-54155326
Sequence CTAGAGCTCTGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096808519_1096808527 -4 Left 1096808519 12:54155304-54155326 CCCTCTTCCCTCCAGAGCTCTAG No data
Right 1096808527 12:54155323-54155345 CTAGGCTGAGTGGCATCAGTGGG No data
1096808519_1096808529 26 Left 1096808519 12:54155304-54155326 CCCTCTTCCCTCCAGAGCTCTAG No data
Right 1096808529 12:54155353-54155375 CTCTCACACTGTAAACAGAGCGG No data
1096808519_1096808526 -5 Left 1096808519 12:54155304-54155326 CCCTCTTCCCTCCAGAGCTCTAG No data
Right 1096808526 12:54155322-54155344 TCTAGGCTGAGTGGCATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096808519 Original CRISPR CTAGAGCTCTGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr