ID: 1096809813

View in Genome Browser
Species Human (GRCh38)
Location 12:54162078-54162100
Sequence CATGGCAAAGAGAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 464}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096809810_1096809813 -10 Left 1096809810 12:54162065-54162087 CCACAGGGGAGAACATGGCAAAG 0: 1
1: 4
2: 5
3: 18
4: 280
Right 1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG 0: 1
1: 0
2: 1
3: 44
4: 464
1096809805_1096809813 6 Left 1096809805 12:54162049-54162071 CCAGCAAGTGACAGCACCACAGG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG 0: 1
1: 0
2: 1
3: 44
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096809813 Original CRISPR CATGGCAAAGAGAAGGGAGC AGG Intergenic
900076109 1:819133-819155 CATGGCAGAGGGGAGGGTGCAGG - Intergenic
900750849 1:4396327-4396349 CATGGCAGAGGCAAGGGAGGAGG + Intergenic
903153672 1:21430143-21430165 CATGGGCCAGAGAGGGGAGCAGG - Intergenic
903173928 1:21569662-21569684 CATTGCTAAGAGAAGGCAGGGGG + Intronic
904489608 1:30850262-30850284 CATGGGAAGGGGATGGGAGCAGG + Intergenic
904529654 1:31160037-31160059 CATGGTAGAGAGAAGGCAGAAGG + Intergenic
904680226 1:32223893-32223915 CTTGGGAAACAGCAGGGAGCTGG - Intronic
904880945 1:33696493-33696515 CATGGCAGGGAGTAGGGTGCTGG + Intronic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
905173834 1:36124612-36124634 AATGGCAGAGAGATGGGGGCAGG + Intronic
905252831 1:36660526-36660548 CAGGGCTCAGAGGAGGGAGCAGG - Intergenic
905781853 1:40718411-40718433 TATGGAAAAGAGAAGGTAGGAGG - Intronic
905933675 1:41807167-41807189 CATGGCAAAGTTCTGGGAGCTGG - Intronic
906201451 1:43963117-43963139 CATAGCCTAGAGAAGGAAGCAGG + Intronic
906693248 1:47806831-47806853 AATGGCACTGAGAAGGCAGCAGG + Intronic
906988431 1:50711881-50711903 AATGGCTAAGTGAATGGAGCAGG - Intronic
907138532 1:52162469-52162491 AAGGGCAAACAGAAAGGAGCTGG - Intronic
908426876 1:64016021-64016043 CTTGGGAAACAGAAGGGAGTTGG - Intronic
908625097 1:66031332-66031354 AATGGAAAGAAGAAGGGAGCAGG + Intronic
908759544 1:67499163-67499185 GGTGGCAGTGAGAAGGGAGCGGG + Intergenic
909579094 1:77212630-77212652 AATGGAAAACAAAAGGGAGCAGG + Intronic
909605946 1:77508444-77508466 CATGGCAAAGGGAAAAGACCTGG + Intronic
910994962 1:93094905-93094927 CAAGGCACAGAGAGGGGAACAGG - Intronic
911126169 1:94343130-94343152 CACTCCAAAGAGAAGGGAGCGGG - Intergenic
912630371 1:111241708-111241730 TAAGGCAAGGAGAAGGGAGAGGG + Intronic
913116343 1:115701122-115701144 GATGGAAAAGGGAAAGGAGCTGG + Exonic
913552528 1:119929496-119929518 CATCTCAAAGAGAAGGAAACTGG + Intronic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
913969454 1:143403426-143403448 CTTGGCACAGGGCAGGGAGCAGG - Intergenic
914063831 1:144229025-144229047 CTTGGCACAGGGCAGGGAGCAGG - Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914115319 1:144737329-144737351 CTTGGCACAGGGCAGGGAGCAGG + Intergenic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
915675231 1:157523725-157523747 CAGGGCAGAGAGTGGGGAGCAGG - Intronic
915730169 1:158047810-158047832 CATGGGTCAGAGAAGGGAGACGG - Intronic
915786685 1:158620960-158620982 CTTGTCAAAGAGAAGTCAGCTGG - Intronic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
918138749 1:181702161-181702183 GATGGAAAAGATAATGGAGCAGG - Intronic
918241906 1:182628015-182628037 CATGGAACAGAGAAGGGCACAGG + Intergenic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
918921263 1:190713266-190713288 CAAGGCAAAGAGAATTGATCAGG - Intergenic
919320093 1:196025544-196025566 CATCCCAAAGGGAAGAGAGCAGG + Intergenic
919786939 1:201264173-201264195 CATGCCCAAGAGAGGGGAGGTGG - Intergenic
920553331 1:206884136-206884158 CAAAGCACAGAGAAGAGAGCTGG - Intergenic
920585447 1:207154920-207154942 CATAGCTAAGGGTAGGGAGCTGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920793384 1:209114187-209114209 AAATGAAAAGAGAAGGGAGCAGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
920962463 1:210675732-210675754 CTTGGCAAAGAGATGGGAGGGGG + Exonic
921662579 1:217822992-217823014 CATAACAAAAAGAAGGGAACAGG - Intronic
922420801 1:225460144-225460166 CATGGCCAAGCGAAAGGTGCAGG + Intergenic
922900110 1:229130076-229130098 AATGGCACAGAGGAGGAAGCTGG + Intergenic
922998634 1:229987241-229987263 CAGGGCAGAAAGAAAGGAGCTGG + Intergenic
924213568 1:241795465-241795487 TATGGCAGAGACAAGGGACCCGG - Intronic
924244728 1:242073159-242073181 CATAGGAAAGAAAGGGGAGCAGG + Intergenic
1062857759 10:787948-787970 AATGGCAAAGAGGCGGGAGCAGG + Intergenic
1063229084 10:4046169-4046191 TATGACAGAGAGGAGGGAGCAGG + Intergenic
1063691642 10:8293080-8293102 CTTGGGAGAGAAAAGGGAGCAGG + Intergenic
1064174827 10:13065729-13065751 CATGCCAAAGAGAATGTTGCAGG - Intronic
1064695504 10:17961197-17961219 CAAGGCTAAGAGAAGGAAGGAGG + Intronic
1066443866 10:35464173-35464195 TAAGGCACAGAGGAGGGAGCTGG - Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067167988 10:43880345-43880367 CATGGAAGGGAGAAGGGACCAGG + Intergenic
1067302525 10:45025201-45025223 CATGGCAACGTGGATGGAGCTGG + Intergenic
1067465326 10:46494026-46494048 CATGAAACAGAGAAGGGAGGGGG + Intergenic
1067621861 10:47890575-47890597 CATGAAACAGAGAAGGGAGGGGG - Intergenic
1067683457 10:48454233-48454255 GTGGGCAAAGAGAAGGGAGGTGG + Intronic
1069181774 10:65369962-65369984 TATGGCACAGAGCAGGGAACGGG + Intergenic
1070147493 10:73785702-73785724 CCTGGGAAAGAGACGGGACCGGG - Exonic
1070719184 10:78744690-78744712 CATGGGAAAGGGAAGAAAGCAGG + Intergenic
1071476594 10:86030904-86030926 GCTGGCAAAGAGAAGGAAGATGG - Intronic
1071486656 10:86106847-86106869 GATGGGATAGAGAATGGAGCTGG + Intronic
1071736417 10:88305502-88305524 AATGGAAAAGAGAAGAAAGCAGG + Intronic
1072054591 10:91741448-91741470 CATGCCAAAGGGAAGAGAGTAGG + Intergenic
1072525669 10:96269510-96269532 CATGGCAGTGAGAAGGAAGAGGG - Intronic
1072526902 10:96279953-96279975 CATGGGAGGCAGAAGGGAGCTGG + Intergenic
1072657831 10:97342780-97342802 AATGGTAAAGAGAAGGCATCAGG - Intergenic
1072875660 10:99170358-99170380 CAGGCCAGAGAGGAGGGAGCTGG - Intronic
1074672201 10:115804462-115804484 CGTGGCAAAGAGCAAAGAGCAGG - Intronic
1075092766 10:119452795-119452817 CATGGCAAAACGAGGTGAGCAGG + Exonic
1076373886 10:129971297-129971319 CATTGCAAAGCGGAGGGCGCCGG + Intergenic
1077431794 11:2519251-2519273 CATGTTGGAGAGAAGGGAGCTGG - Intronic
1077866944 11:6230214-6230236 AGAGGCAAAGAGGAGGGAGCTGG + Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079306939 11:19331607-19331629 GTTGGCAGAGAGAAGGGAGAAGG - Intergenic
1079356921 11:19737434-19737456 CATGGCAGGGAGAAGGGATGGGG + Intronic
1080112400 11:28582716-28582738 CATGGCTTACAGCAGGGAGCAGG - Intergenic
1080849235 11:36053948-36053970 CAGGGCAAAGGGAAGAGTGCAGG - Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081588961 11:44407657-44407679 CAGGGCAGAGAGAAAGGAGCTGG - Intergenic
1081984468 11:47291518-47291540 CATGGCAATGAGATGTCAGCTGG - Intronic
1083424456 11:62575898-62575920 CGTAGCAGAGAGCAGGGAGCTGG + Exonic
1083632688 11:64103955-64103977 CAGGGCACAGAGAGGGGATCCGG - Exonic
1084287677 11:68142486-68142508 CATGGCAGGGTGAGGGGAGCAGG + Intergenic
1085049433 11:73372544-73372566 CCTGGCAAAGGCAAGTGAGCTGG + Intergenic
1085330427 11:75645193-75645215 CAAGGCAAGGAGAAGAGACCTGG + Intronic
1086226740 11:84520612-84520634 CATGATAAAGAAAAAGGAGCTGG - Intronic
1087452179 11:98338670-98338692 AATGGTAAATAAAAGGGAGCAGG - Intergenic
1087792806 11:102424791-102424813 CCTGGCACAGAAAAGGGAGCGGG + Intronic
1088064458 11:105699205-105699227 CATAGCACAGAGGAGGGAACAGG - Intronic
1088643650 11:111897961-111897983 CATGGCAAAAAATAGAGAGCTGG - Intergenic
1089379732 11:118019477-118019499 AATACCAGAGAGAAGGGAGCTGG + Intergenic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1089663680 11:120002768-120002790 GAAGGAAAAGTGAAGGGAGCTGG - Intergenic
1090351782 11:126112599-126112621 CATGACAGAGAGACAGGAGCTGG + Intergenic
1095929946 12:47615123-47615145 CATGGCAAAGAGCAGAGAGAGGG + Intergenic
1096077737 12:48815533-48815555 CAGGGGAGAGGGAAGGGAGCAGG + Intronic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1097606697 12:61763796-61763818 GAGGTCAGAGAGAAGGGAGCAGG + Intronic
1098034505 12:66288356-66288378 CAAGGAAATGAGAAGGTAGCTGG + Intergenic
1098267660 12:68738699-68738721 AATGGCAGAGAGAATGGAGCAGG + Intronic
1101159046 12:101955117-101955139 CATTTCATAGAGAAGGGAGGGGG + Intronic
1101812489 12:108119991-108120013 CATGGGAAACAAAGGGGAGCTGG - Intergenic
1102090660 12:110184592-110184614 AAGGGTAAAGGGAAGGGAGCAGG + Intronic
1102189144 12:110973077-110973099 CATGGCCAAGGGAAAGGAGGTGG - Intergenic
1102904357 12:116662758-116662780 CAAGGCAAGGAGAAAGGAGAGGG - Intergenic
1103039618 12:117684458-117684480 CATGGAAATGAGCAGGGAGGGGG + Intronic
1103298509 12:119908565-119908587 CTTGGCAAAGGAAAGGGAGCTGG - Intergenic
1103617313 12:122162514-122162536 GAGGGAAAAGAGGAGGGAGCAGG - Intergenic
1103701996 12:122853100-122853122 AATGACAAAGAGCAGGCAGCTGG - Intronic
1104352049 12:128053269-128053291 CATGACAAAGATATGGGTGCGGG - Intergenic
1104876440 12:132038238-132038260 CATGACAGAAAGAAGGGAGTGGG - Intronic
1105206366 13:18228904-18228926 CATGACAAAGAAAAGGAGGCCGG + Intergenic
1105441823 13:20421597-20421619 AAAGGCAAAGAGAAGAGAGGTGG - Intronic
1105687480 13:22799441-22799463 CATTGCAAACAGAATGGAGTAGG + Intergenic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106762939 13:32884923-32884945 CATGGCAGAGAGAAGAAAGCTGG + Intergenic
1106792942 13:33174521-33174543 CATGGTAAAGGGAAAAGAGCAGG - Intronic
1107435364 13:40376635-40376657 AATGCCCAAGAGCAGGGAGCAGG - Intergenic
1109938746 13:69330439-69330461 CATGGCAAAGAGCAGGGAAGGGG - Intergenic
1110370745 13:74737579-74737601 CATTGAGAAGGGAAGGGAGCAGG + Intergenic
1111531088 13:89538919-89538941 AATGGAAAACAGAAGAGAGCAGG - Intergenic
1112666006 13:101574337-101574359 CATAGCTAAGAGAAGTGAGATGG - Intronic
1114255729 14:20999922-20999944 CAGGACAAAGGGAAGAGAGCGGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1115782604 14:36786269-36786291 CATGCCAAACAGCAGGGAACAGG - Intronic
1116953470 14:50899542-50899564 CATGGCCAAGAGAAGGAAATAGG - Intronic
1117650263 14:57897341-57897363 AATGACAAAGAGAAGGCATCAGG + Intronic
1117804650 14:59479135-59479157 CATGCCACAGAGAAGGGAATTGG + Intronic
1118318171 14:64738048-64738070 GAAGGCAACGAGAAGGGGGCTGG + Intronic
1118923529 14:70171233-70171255 CATGGGGGAGAGAAGAGAGCCGG + Intronic
1119102789 14:71895769-71895791 GAAGGGCAAGAGAAGGGAGCTGG + Intergenic
1119783653 14:77296404-77296426 CATGGGAGTGAGAAGGTAGCTGG - Intronic
1119964029 14:78893098-78893120 GATGGCAAAGAAAAGGAAGGTGG - Intronic
1120206011 14:81588590-81588612 CAAGGCAATAAGAAGGGAGCAGG + Intergenic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1120956487 14:90087821-90087843 GAAGGCAGAGACAAGGGAGCAGG - Intronic
1120974104 14:90233993-90234015 CATAGCAAGGAAAAGGGAGCAGG + Intergenic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1121413300 14:93762454-93762476 CAGGGCACAGAGAAGATAGCTGG - Intronic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1122091607 14:99344390-99344412 GATGGCGAGGAGAAGGGAGAAGG + Intergenic
1122125895 14:99578601-99578623 CATGACCAAGAGGAGGGTGCAGG - Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124721422 15:32114473-32114495 CATGGGAAAGAGGAACGAGCAGG - Intronic
1124876554 15:33600446-33600468 CATGGCAAAGCGAACTGTGCCGG - Intronic
1125017548 15:34951202-34951224 GATGGCATGGAGAAGGTAGCTGG - Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125384056 15:39117478-39117500 AATGGAAAAGACAAGAGAGCAGG + Intergenic
1126844379 15:52745465-52745487 GGTGACAAAGAAAAGGGAGCGGG - Intergenic
1127310209 15:57745571-57745593 AATGGCAAAGGGAAGGGGCCGGG - Intronic
1128269890 15:66299590-66299612 CCTGGAAAAAAGAAGGGAGGAGG + Intronic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1129377423 15:75142755-75142777 CATGGCATAGAGAAGGTATAGGG - Intergenic
1129941975 15:79506042-79506064 CCTGGAAGAGAGAAGGGAGCTGG - Intergenic
1129957819 15:79655315-79655337 CATGGCAGTGAGAGGAGAGCTGG - Intergenic
1130727336 15:86452849-86452871 CAGGGCAAAGAGAATGAATCTGG - Intronic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1130982204 15:88820538-88820560 CAAGGCAGGGAGAAAGGAGCAGG - Intronic
1131689373 15:94809973-94809995 GAGGGAAATGAGAAGGGAGCAGG - Intergenic
1132133699 15:99310570-99310592 CATGCCAAAGAAAAGTGAACAGG + Intronic
1132540955 16:509539-509561 CATCCCAAAGAGAAGGGCACAGG - Intronic
1132865506 16:2091103-2091125 CTTGGCACAGGGAAGGGCGCTGG - Exonic
1132951372 16:2564221-2564243 CCTGGCAAACAGAAGTGAGCAGG + Intronic
1132962978 16:2635949-2635971 CCTGGCAAACAGAAGTGAGCAGG - Intergenic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1133900693 16:9971382-9971404 CATGGCTAAGTGGATGGAGCTGG - Intronic
1133976359 16:10602118-10602140 CAAGGCTGAGAGATGGGAGCAGG + Intergenic
1134543216 16:15086696-15086718 CAGGGCAAACAGAAGTGATCAGG - Intronic
1134867257 16:17619635-17619657 GATGGGGAAGAGAAGGGAGAAGG + Intergenic
1136222399 16:28836698-28836720 GAGGGGAAAGAGAAGAGAGCAGG - Intronic
1136597445 16:31261160-31261182 GATGGGAAAGGGAATGGAGCAGG + Intronic
1136735530 16:32462953-32462975 CATGGCAAAGGGAACAGAGTGGG - Intergenic
1138061599 16:53897031-53897053 GATGTCAATGAGGAGGGAGCAGG - Intronic
1138177341 16:54912692-54912714 GATGGGAGAGAGAAGAGAGCAGG - Intergenic
1138309683 16:56012650-56012672 CATTGCAGAGACAGGGGAGCAGG - Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138505970 16:57478433-57478455 AATGGGAGAGAGAAGGGAGAAGG + Intronic
1139565159 16:67770518-67770540 TATGACACAGAGAAGGCAGCTGG - Intronic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140967388 16:79980158-79980180 CATGGCAGAGAGAAGCCAGGTGG + Intergenic
1141477675 16:84284485-84284507 CTTCGCAAAGAGCAGGGAGCAGG - Intergenic
1142069965 16:88086707-88086729 CAAGGCAAAGGGAAGGGAAGTGG - Intronic
1142246438 16:88972290-88972312 ACTGGCACAGAGCAGGGAGCAGG - Intronic
1142971512 17:3615009-3615031 CAAGGATAAGAGAAAGGAGCAGG + Intronic
1143476046 17:7204567-7204589 GATGGCAAAGAGTGGGGAGAGGG + Intronic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1144116398 17:12096623-12096645 CATCCCAAAAAGAAGAGAGCAGG - Intronic
1144658993 17:17056315-17056337 CATGGCAAAGGGAAGAGGGCTGG - Intronic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1146376380 17:32297520-32297542 CATGGCCCAGTGAATGGAGCAGG + Intronic
1146499574 17:33352863-33352885 CATGGGAAAGAGAAGGTAAGGGG - Intronic
1146935598 17:36810816-36810838 TATGGAAATGAGAAGGGAGTGGG - Intergenic
1147562582 17:41518296-41518318 GATGTCAAAGAGAGGGGAGCAGG - Intronic
1148610590 17:48962019-48962041 CTTGGCATAGAGCAGGGAGAAGG + Intronic
1149016518 17:51914642-51914664 CATGGCAAAGAGAAGGAAATTGG + Intronic
1150317838 17:64184780-64184802 TATGGGCAAGAGAATGGAGCTGG - Intronic
1151061603 17:71100956-71100978 CATGGCAAGAAGGAGAGAGCTGG + Intergenic
1151185616 17:72361893-72361915 GAGGGAAAAGAGGAGGGAGCTGG - Intergenic
1151363788 17:73604369-73604391 CAGGGCACAGGGAAGGGACCTGG + Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153327787 18:3839505-3839527 CTGGGCAAAGAGAAGAGAGGAGG + Intronic
1154111053 18:11568702-11568724 AATGGCACGGAGAAGGGATCAGG - Intergenic
1155408234 18:25513427-25513449 AAAGGCAAAGGGGAGGGAGCAGG - Intergenic
1155520052 18:26658335-26658357 AATAGCAAAGAGAAGGGAGGAGG - Intergenic
1156502863 18:37570683-37570705 AAGGGCAAAGTGAAAGGAGCAGG + Intergenic
1156899079 18:42279351-42279373 AATGGCAGAGAGCAGGGAGAGGG - Intergenic
1157127888 18:44974439-44974461 AAAGGCAAAGAGGAGGGAGTTGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157564885 18:48673100-48673122 CATGCCACAGAGATGGGGGCAGG - Intronic
1159308351 18:66675122-66675144 CATAGCAAAAAAAAGGGAGATGG - Intergenic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161950221 19:7463678-7463700 CACGGCACACAGAAGGGGGCAGG + Intronic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164969415 19:32518486-32518508 TATTGCAAAGAGAAGGGAAGTGG - Intergenic
1165182865 19:33987719-33987741 GAAGGCAAAGGGAAGGAAGCTGG + Intergenic
1165816387 19:38645019-38645041 CCTGGGAAAGAGAAGGGGGTGGG + Intergenic
1166776949 19:45318794-45318816 CATTGCAAGGCGAAGAGAGCTGG - Intronic
1167598075 19:50437731-50437753 CTTGGCACAGAGAGGGGAGATGG + Intronic
1168444940 19:56403949-56403971 CATCGCTGAGAAAAGGGAGCTGG - Intronic
924979331 2:206963-206985 CATGGGAAAGAGAGGGAAACTGG + Intergenic
925071023 2:966150-966172 TGTGGCACAGAGAAGGGAGGTGG - Intronic
925313528 2:2905089-2905111 CATGGCAGAGTGCAGGGAGCTGG + Intergenic
925384086 2:3449923-3449945 AATGGCAAAGAGCAGGGAAGTGG - Intronic
925919377 2:8628512-8628534 CATGGCACGGAGAAGGCAGTTGG + Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
927669000 2:25053256-25053278 CAAAGCAAAGCTAAGGGAGCTGG - Intronic
928435235 2:31250684-31250706 CATGGCACAGAGAGGGTAGTGGG - Intronic
929825289 2:45305297-45305319 CATGGCAAGCAGTAGGCAGCAGG - Intergenic
929919537 2:46162367-46162389 GATGGCAAAGAGAAAGGATGGGG + Intronic
929947203 2:46380543-46380565 CATGGAAGAGAGAGGGGTGCTGG - Exonic
931126321 2:59281703-59281725 CATGGCAAAAAAAAGGAACCAGG + Intergenic
931259647 2:60606090-60606112 CATGGCAGAGTGAGAGGAGCTGG + Intergenic
932183186 2:69668094-69668116 CAAGGCAAAGAGTGTGGAGCCGG + Intronic
932499650 2:72172739-72172761 CATGCCACAGAGTAGGGAGCAGG - Intergenic
932892349 2:75608029-75608051 GAAGGCAAAGAGAAGGTAGTTGG - Intergenic
934174145 2:89564329-89564351 CTTGGCACAGGGCAGGGAGCAGG - Intergenic
934284461 2:91638678-91638700 CTTGGCACAGGGCAGGGAGCAGG - Intergenic
934990247 2:98915402-98915424 CAAGGCACAGGGCAGGGAGCAGG + Intronic
935443741 2:103135023-103135045 CATGGTACAGAGAACAGAGCAGG + Intergenic
938063151 2:128267533-128267555 CATGGGCCAGAGAGGGGAGCAGG + Exonic
939129801 2:138221490-138221512 CATGGCAAAAACAAGGTAACTGG + Intergenic
939300073 2:140325176-140325198 TATGAGGAAGAGAAGGGAGCTGG + Intronic
939575879 2:143893899-143893921 CAATGCAAAGAGAAAGGGGCCGG - Intergenic
939607262 2:144268224-144268246 CATGGCAGAAGAAAGGGAGCAGG - Intronic
939810684 2:146828213-146828235 CATGGCAAACAGAAAAGAGCAGG + Intergenic
940434398 2:153633632-153633654 CATGGCAAAGAGGAACAAGCTGG - Intergenic
941163415 2:162060414-162060436 CATGGAAAAGAGAATAGAGATGG - Intronic
942292539 2:174486894-174486916 AGTGGCGAGGAGAAGGGAGCTGG + Exonic
942724918 2:178995716-178995738 AATAGCAAAGAGAACAGAGCTGG - Intronic
943077039 2:183208396-183208418 CAAGCCAAGGAGAAGGGAACCGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944693006 2:202174694-202174716 CATGGGAGAGAGAAAGGAGTTGG - Intronic
945023582 2:205598283-205598305 AATGGAAAACAGAAAGGAGCAGG + Intronic
945519258 2:210802891-210802913 CTTGGCAAAGGAAAGTGAGCTGG - Intergenic
946201369 2:218072673-218072695 CTTGGCAATGGGAAGGGTGCAGG - Intronic
946229830 2:218284385-218284407 CTTGGCTCAGAGGAGGGAGCAGG - Intronic
946593977 2:221285521-221285543 CAGGGGAGAGAGAAGGGAGTTGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947058952 2:226140028-226140050 CATGGCACAGAGCAGGAAGGTGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947938444 2:234027151-234027173 CATGACAGAGAGTAGGGAGTGGG - Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948855654 2:240729396-240729418 AAGGGCACAGAGAAGGGAGTAGG - Intronic
949045986 2:241872873-241872895 GAAGGCAAAGAGAAGGAAGGTGG + Exonic
1169228571 20:3871607-3871629 CATTCCTAAGAGATGGGAGCAGG - Exonic
1169632152 20:7646256-7646278 CATGGACAAAAGAGGGGAGCTGG - Intergenic
1169820544 20:9704933-9704955 TGTGGGAAAGAGAAGGTAGCAGG - Intronic
1169982883 20:11406478-11406500 AATGGCAAAGATAAAGGTGCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170663569 20:18365430-18365452 CATGGCAGAGAGAGTGGAGTAGG - Intergenic
1173152897 20:40583045-40583067 TATGCCAAAGAGAAGAGACCTGG + Intergenic
1173268650 20:41511090-41511112 CATGGAAAGTAGCAGGGAGCAGG - Intronic
1173331550 20:42079921-42079943 TATGTCAAAAAGAAGGGGGCGGG - Exonic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1175040306 20:56043394-56043416 CATTTCACAGAGAAGGGAACAGG + Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176014480 20:62922807-62922829 CTTGGCACAGGGAAGAGAGCGGG + Intronic
1177213565 21:18100297-18100319 GAAGGCAAACAGAAGTGAGCAGG + Intronic
1177238607 21:18427241-18427263 GTTGGCAAAGAGCAAGGAGCGGG - Intronic
1178522566 21:33298883-33298905 GACGACAAAGAGAAGGGAGGAGG - Intergenic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1179627606 21:42657531-42657553 CATAGGCAAGAGAAAGGAGCAGG - Intronic
1179732381 21:43374989-43375011 CATAGCAGAAAGAAGGGAGCCGG - Intergenic
1179960680 21:44765617-44765639 GATGGCAAAGTGAAAGGAACTGG - Intergenic
1182320903 22:29478255-29478277 GAGGGCAAAGAGAAAGGAACTGG + Intergenic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1183600715 22:38838875-38838897 CATGGAAAAGACAGGTGAGCTGG - Intronic
1183829239 22:40409220-40409242 CATGGCCAGGAGTGGGGAGCAGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184742677 22:46438180-46438202 CAAGGCCCAGAGAAGGGGGCCGG + Intronic
1184943938 22:47787802-47787824 CATGGCAGAGCGAAGGGACTGGG + Intergenic
949513377 3:4785861-4785883 AATGGTAAAGAGAAGTGACCAGG + Intronic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
949955894 3:9268342-9268364 TATGGCAGAGAGAAGAGAGAGGG - Intronic
950002951 3:9671471-9671493 CATGGCATAGAACATGGAGCTGG - Intronic
950014790 3:9747907-9747929 TATGGGAAAGAGAAGGGAAATGG - Exonic
950321297 3:12056681-12056703 CATGGTAATGAGTAGGGGGCAGG + Intronic
951219801 3:20057091-20057113 CCTGGCAATGAGAATGGAGAAGG + Intronic
951233750 3:20210874-20210896 CAAGGAAAAGTGAAGGAAGCAGG - Intergenic
951613754 3:24520579-24520601 GCTGGGAAAGAGCAGGGAGCAGG - Intergenic
952041053 3:29262444-29262466 CCTGGCAAAGAGAAGGACCCTGG - Intergenic
952917096 3:38254897-38254919 CATGGCAAATAGAATTGGGCTGG + Exonic
953020338 3:39108989-39109011 CAGGGGATAGGGAAGGGAGCAGG + Intronic
953520745 3:43640326-43640348 CATGGTGAAGAGAAGGCATCTGG + Intronic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953876550 3:46670006-46670028 CAGGGCAAAGCGTAGGGAGAGGG - Exonic
955516352 3:59730181-59730203 AATGGAAATGAGCAGGGAGCTGG - Intergenic
955866277 3:63387955-63387977 GAGGGCAAAGGGATGGGAGCAGG + Intronic
955875387 3:63484543-63484565 CATGGCAAAGGCAATGGAGAAGG + Intronic
956446637 3:69332211-69332233 CTTGCAGAAGAGAAGGGAGCAGG + Intronic
956672171 3:71701235-71701257 CTTGGCAAAGACAAGTGATCTGG + Intronic
956873208 3:73438509-73438531 CATGTCAAAAAGAAGTGAGATGG + Intronic
957155429 3:76538296-76538318 CGTAGAAAAGAGAAGGGAGAGGG - Intronic
959243868 3:103837424-103837446 AATGGGAATGAGAAGGCAGCAGG + Intergenic
959371058 3:105526484-105526506 CATCAAAAAGAGAAGGGAGTAGG - Intronic
961172302 3:124806247-124806269 GATGGAAAAGAGATGGGAGAGGG - Intronic
962174295 3:133136729-133136751 CTTGGCAGAGGAAAGGGAGCTGG + Intronic
962626696 3:137232395-137232417 CTTGGCAGAGAGCAGGGAACAGG + Intergenic
962915233 3:139895336-139895358 CATGGCAATGAGGATGGATCTGG - Intergenic
963557326 3:146809047-146809069 GAGGCCAAAGAAAAGGGAGCAGG - Intergenic
966640747 3:182187070-182187092 CATTGCAAAGAAAAGAGATCAGG - Intergenic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
971885036 4:32433687-32433709 AATGGCAAAGAGAAATCAGCAGG + Intergenic
972341322 4:38154988-38155010 CATGGCAAAGGGCTGGGTGCTGG - Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
974378930 4:61112821-61112843 CATGGCAAAGCGATGGGTGGGGG - Intergenic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976396961 4:84566234-84566256 GGTGACAAAGAAAAGGGAGCAGG + Intergenic
977319540 4:95495229-95495251 CATTCCCAAGAGAAGGGAGTGGG - Intronic
977868185 4:102056496-102056518 CATGACTAAGAGAAAAGAGCAGG + Intronic
978644679 4:110915844-110915866 CATGGAATAAAGAATGGAGCAGG + Intergenic
978672494 4:111267218-111267240 AATTGCAAAGAGAAAGAAGCTGG + Intergenic
980583277 4:134782619-134782641 AATGGAAAACAGAAGTGAGCAGG - Intergenic
981532595 4:145766505-145766527 CATTGCAGAGAGAAGGAACCAGG + Intronic
981541717 4:145853218-145853240 CCAGGCAAAAAGAAGAGAGCTGG - Intronic
982729733 4:158943437-158943459 GATGGGAATGAGAAGTGAGCAGG - Intronic
982955150 4:161755451-161755473 CATGGCAGAGAGAAAGAACCTGG + Intronic
984114532 4:175663355-175663377 CATGCTAAAAAGAAGTGAGCTGG + Intronic
986418169 5:7549330-7549352 CATGGCAAATGGAAGGGAGATGG + Intronic
987550583 5:19375159-19375181 CAGGGCGGAGGGAAGGGAGCAGG + Intergenic
988050102 5:26016462-26016484 CATGAAAAAGAGAATGAAGCTGG + Intergenic
989525740 5:42452228-42452250 CTTGCCAATCAGAAGGGAGCAGG - Intronic
989606432 5:43248519-43248541 AATAGAAAAGAGGAGGGAGCTGG + Intronic
990230686 5:53710497-53710519 CATGGAAAACGGAAGAGAGCAGG - Intergenic
990526611 5:56634328-56634350 TGTGCCAAAGAGAAGGAAGCAGG - Intergenic
990543221 5:56795537-56795559 CAATGCCAAGAGAAGGGACCTGG - Intergenic
990846735 5:60148943-60148965 CAGGGCAAAGTAAAGGGAGATGG + Intronic
991156303 5:63440575-63440597 CATGGCAGAGGGCAGGGAGGTGG - Intergenic
991961734 5:72051404-72051426 CATGGCCAAGAGAAGTGATATGG - Intergenic
992159390 5:73985927-73985949 CATGGGAAAGAAAGAGGAGCTGG + Intergenic
992305349 5:75431527-75431549 CATAACACAGAGAAGGGATCAGG - Intronic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992769234 5:80031674-80031696 CATGGCAAAGGCAAAGGTGCAGG + Intronic
993196772 5:84758463-84758485 CAGGTAAAAGAGAAGTGAGCAGG - Intergenic
993647427 5:90477496-90477518 CATGGGAGAGAGAACAGAGCTGG + Intronic
993836137 5:92822440-92822462 AAGGGCAAGGAGAAGAGAGCTGG + Intergenic
994881013 5:105496253-105496275 CATGGAAAAAAGAAAAGAGCTGG + Intergenic
995070972 5:107921518-107921540 CATGGCATAGAGGAAGGGGCTGG + Intronic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
995239131 5:109865871-109865893 CATGACTCAGAGAAGGCAGCTGG + Intronic
995442432 5:112206623-112206645 AAAAGCAAAGAGAAGGGAGAAGG + Intronic
996020712 5:118588056-118588078 CATGGCAAACGGTAGGCAGCTGG - Intergenic
997657539 5:135566624-135566646 ACAGGCAGAGAGAAGGGAGCTGG + Intergenic
998327738 5:141296830-141296852 GATGGCAAAGAGAAGAGGGGAGG + Intergenic
999065132 5:148677334-148677356 TATGGCAAAGAAAGGGCAGCAGG - Intergenic
999083565 5:148866907-148866929 CATGCCAAAGAGCAGGGGCCTGG + Intergenic
999147875 5:149407711-149407733 TATGGCCCAGAGAAGGGAGGGGG - Intergenic
999326752 5:150648841-150648863 GATGTCAATGAGCAGGGAGCTGG - Exonic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1001334391 5:170785279-170785301 CAGGGCAAAGAAAAGGGACTTGG + Intronic
1001437530 5:171711894-171711916 GTTTGCAAAGAGAAGGGAGACGG + Intergenic
1001483480 5:172104073-172104095 CATGGCACACAGTAGGAAGCTGG + Intronic
1002043903 5:176531721-176531743 CGTGGAGAAGGGAAGGGAGCCGG - Intronic
1002295473 5:178228501-178228523 CTCTGGAAAGAGAAGGGAGCTGG - Intronic
1002601907 5:180358602-180358624 TCTGGCAGAGACAAGGGAGCTGG + Intergenic
1003075953 6:2983803-2983825 CATGGCAAAGAGGACAGAGAAGG + Intergenic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1005030133 6:21500870-21500892 CATTGCAAAGTGCAGGGAGCTGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006812749 6:36830635-36830657 CATGGCCAAGGGAAAAGAGCAGG + Intronic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008884671 6:56419234-56419256 CCAGGCAAAGTGTAGGGAGCTGG - Intergenic
1010590512 6:77706803-77706825 CATGGCAGAAAGCAGGGAGCCGG - Intronic
1010705263 6:79101264-79101286 CATGGCAAAAAGATGTAAGCCGG + Intergenic
1012304779 6:97640808-97640830 CATGGAAAAGAGAAGAAATCAGG - Intergenic
1012368497 6:98472839-98472861 AATAGCAATGAAAAGGGAGCAGG + Intergenic
1014323720 6:119965956-119965978 CATGGTAATGATACGGGAGCAGG + Intergenic
1014483780 6:121973466-121973488 AATGGAATAGAGAAGGGAACTGG - Intergenic
1015119137 6:129682298-129682320 CTTGGCAAAGAGAAAGGCGTGGG - Intronic
1015162376 6:130168019-130168041 AATGGCAAAGAGAATGCAGTGGG + Intronic
1015712690 6:136159430-136159452 GATAGCTGAGAGAAGGGAGCGGG - Intronic
1015841062 6:137477849-137477871 CATTGCACAGAGAAGGAAACAGG + Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016608296 6:145960369-145960391 CATGGCAAAGAGCATGGATATGG + Intronic
1017926238 6:158913852-158913874 AACAGCAAAAAGAAGGGAGCTGG - Intergenic
1018963892 6:168468464-168468486 CATGGCAGGGAGAAGGCAGTCGG - Intronic
1019422416 7:957238-957260 CAAGGCATAGAAAAGGCAGCAGG + Intronic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1019890430 7:3941661-3941683 AAAGCCAAAGAGAAGGGAGATGG - Intronic
1019971503 7:4544510-4544532 CATGAAGAAGAGAAGAGAGCGGG - Intergenic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1022467197 7:30660076-30660098 TTTGGCAAAGGGCAGGGAGCTGG + Intronic
1022494532 7:30844585-30844607 CCTGGAGAAGAGAAGGGAGGTGG + Intronic
1026132300 7:67630502-67630524 AATGGTAAAAAGAAGAGAGCAGG - Intergenic
1027626438 7:80550851-80550873 AATGGGAAGGAGAATGGAGCAGG - Intronic
1027921523 7:84401558-84401580 CTTGGCAAAGAGAATAAAGCTGG + Intronic
1027980035 7:85206238-85206260 CATGGAGAATAGAAGGGAGAAGG - Intergenic
1028920949 7:96309554-96309576 CATGGCAAAGTAAAGGGGGAAGG - Intronic
1029241602 7:99167171-99167193 CAGGGCACAGAGGTGGGAGCTGG - Intergenic
1029530529 7:101122299-101122321 GAGGTCAGAGAGAAGGGAGCAGG + Intergenic
1030252572 7:107463741-107463763 CATGGGGAAGACAAGGTAGCGGG + Intronic
1031044373 7:116871129-116871151 CATGGGAAAGAGGAGAGGGCAGG + Intronic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1032620080 7:133520750-133520772 GGAGGTAAAGAGAAGGGAGCGGG - Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033567228 7:142591057-142591079 CATGCCAAAGAGAGGTGTGCTGG - Intergenic
1034116894 7:148591524-148591546 CTAGGCAAGGAGAAGGGAACAGG - Intronic
1034286248 7:149885110-149885132 CATGGCCAGGAGCAGGGAGAGGG - Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034844327 7:154430464-154430486 CATGGCAGAGAGCACAGAGCAGG + Intronic
1035463269 7:159059656-159059678 AATAGCAAGGAGAAGGGATCTGG - Intronic
1035533902 8:376613-376635 CATGGCAGAGGGGAGGGTGCAGG + Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1037378930 8:18263532-18263554 GATGGCAAAAAGAAAGGAGGAGG - Intergenic
1037385099 8:18331009-18331031 GATGGGGAAGGGAAGGGAGCAGG + Intergenic
1037660524 8:20922444-20922466 CATAGCAAAGAGCAAGGAGTGGG - Intergenic
1037823387 8:22146706-22146728 CATCTCAGAAAGAAGGGAGCTGG + Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1042066893 8:64887448-64887470 CATGGAGAAGAGAAGAGAGTAGG - Intergenic
1042806564 8:72776679-72776701 CATGGCCAAGAAAAGGGTGTAGG + Intronic
1043111297 8:76186399-76186421 CATGGCAGACAGAAAGGAGAAGG + Intergenic
1043243488 8:77967406-77967428 CATGGAAAAGAGGTGGGAGGAGG + Intergenic
1044035589 8:87299279-87299301 CATGGCCAGGAGAAGGGACAGGG - Intronic
1044082574 8:87903881-87903903 CATGGCAAAGCTCAGGGGGCAGG - Intergenic
1045777711 8:105825247-105825269 AAAGGCAAAGAGGAGGCAGCAGG + Intergenic
1047255807 8:123212690-123212712 CAGGGGAAAGAGAATGGTGCTGG + Intergenic
1047326057 8:123836899-123836921 AATAACAAAGAGAAGGAAGCGGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048842379 8:138577285-138577307 CCTGGCAAAGAGAAGAGGGGAGG - Intergenic
1048873226 8:138815876-138815898 CATGGGCCTGAGAAGGGAGCAGG - Intronic
1049314973 8:141960747-141960769 CAATGTAGAGAGAAGGGAGCCGG + Intergenic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053430916 9:38041259-38041281 CATGGTTATGGGAAGGGAGCTGG - Intronic
1055329947 9:75173348-75173370 ACTGACAAAGAGGAGGGAGCAGG + Intergenic
1055357670 9:75454175-75454197 GATGGGAAAGTGCAGGGAGCTGG - Intergenic
1055467252 9:76577864-76577886 CAAGGCATTGAGAAGGAAGCTGG - Intergenic
1055913946 9:81380955-81380977 CATGGAACAGAGAAGGAAGGCGG + Intergenic
1056775825 9:89511974-89511996 CATGGCAGAGAGATGGAAGAGGG - Intergenic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1057789408 9:98113742-98113764 AATGGCAAAGAAAAGGTAACTGG + Intronic
1058747783 9:108008513-108008535 CATGGGAAAGAGAAGAGAATAGG + Intergenic
1059492947 9:114684317-114684339 CAGGTGAAAGAGAAGAGAGCGGG - Intergenic
1059632040 9:116135274-116135296 CATGCCAAATACAAGGGAGAAGG - Intergenic
1059931406 9:119264528-119264550 CAGGGCAATGAGGAAGGAGCTGG - Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061299294 9:129695552-129695574 CCTGGCACAGAGCTGGGAGCCGG + Intronic
1061884874 9:133586388-133586410 CTTGGCACAGAGTGGGGAGCTGG + Intergenic
1061904871 9:133691450-133691472 CATGGCAGAGAGCAGTGAGAAGG + Intronic
1062270120 9:135704480-135704502 CATGGCATGGAGGTGGGAGCAGG - Intronic
1185532468 X:832905-832927 CATGGGAAAGAGGAGGGGGTTGG + Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186451538 X:9677888-9677910 CATGGGTCAGAAAAGGGAGCTGG + Intronic
1186940763 X:14505103-14505125 CATGACACAGAGAAGTAAGCAGG + Intergenic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187665265 X:21601567-21601589 CATAGGAAAGAGATGGGAGGAGG - Intronic
1187783052 X:22850876-22850898 AATGGCAAAGAGAAGAGAATCGG + Intergenic
1190500347 X:51070054-51070076 AACAGCAAAGAGAAGAGAGCTGG + Intergenic
1191103395 X:56757679-56757701 GAAGGGAAAGAGAAGGGAACGGG + Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1196097263 X:111813873-111813895 CATGCCAAAGAGAAGCGAGAGGG + Intronic
1196120473 X:112045114-112045136 CATGGCAAAGAGATGGGGTGTGG + Intronic
1197868582 X:131044442-131044464 AAAGGCAAAGAGAAGAGAGGAGG + Intergenic
1198074319 X:133180206-133180228 CAAGGCATAGAGAGGGGAGGGGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199991970 X:152992590-152992612 CCTGGCAAAGAGTGGGGAGAGGG - Intronic
1200142368 X:153908497-153908519 CATGGTACAGAGCACGGAGCAGG + Intronic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1202095223 Y:21242777-21242799 TATGGCAAAGAGAAAGCACCTGG - Intergenic