ID: 1096811265

View in Genome Browser
Species Human (GRCh38)
Location 12:54171854-54171876
Sequence GGCCCGAGTGACCACAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096811265 Original CRISPR GGCCCGAGTGACCACAGCAA TGG (reversed) Intronic
900120848 1:1048102-1048124 GGCCCGAGGGGTCACAGCAGAGG - Exonic
900290044 1:1919916-1919938 GACCCGAGGGACCACACCCAAGG - Intergenic
900575753 1:3381737-3381759 CGCGTGAGTGACCACAGCCATGG - Intronic
902362200 1:15948030-15948052 GGCCGCAGTGAACACAGGAAAGG - Intronic
902923855 1:19683028-19683050 GGCTGGACTGACCACAGCAGGGG - Exonic
903457433 1:23497435-23497457 GAAACAAGTGACCACAGCAAAGG - Intergenic
904058115 1:27685748-27685770 TGCCCGCGTGGCCACAGCACAGG + Intergenic
904966844 1:34380766-34380788 GCCCCCAGTGACCCCAGGAATGG + Intergenic
906526333 1:46495287-46495309 GGACCCAGTGCCCAGAGCAAGGG - Intergenic
909973322 1:82017058-82017080 AGCTGGAGTGACTACAGCAATGG - Intergenic
911255441 1:95627934-95627956 GGCCAGAGTGATGGCAGCAAAGG + Intergenic
912761240 1:112369524-112369546 GGCCTGTGTGCCCACAGCACTGG + Intergenic
914329653 1:146654979-146655001 GGCCCTAGGGACCTCAGCACTGG + Intergenic
916040157 1:160954769-160954791 GCTCCGAGTGTCCACAGGAAGGG - Exonic
918398574 1:184141487-184141509 AGACCGAGTGAAAACAGCAACGG + Intergenic
1063004265 10:1953045-1953067 GGCCTGAGTGACCTCAGGAGAGG + Intergenic
1063423748 10:5935264-5935286 CAACCGAGTAACCACAGCAAGGG + Intronic
1064112356 10:12550121-12550143 GGCAGCAGTGACCACAGCCAAGG - Intronic
1065256410 10:23873650-23873672 GGCCAGAAAGACAACAGCAATGG - Intronic
1067581110 10:47446607-47446629 GGCCTAAGTGACCTCACCAAGGG - Intergenic
1067837587 10:49651105-49651127 GGCCCGAGTGGGCACAGCTTGGG + Intronic
1069723882 10:70565531-70565553 GGCCAGAGTGGGCACAGGAAGGG + Intronic
1070319243 10:75342559-75342581 TGGCCCAGTGACCACAGCCAAGG + Intergenic
1077281347 11:1747583-1747605 GGGCCGAGCGCCCACAGCCAGGG + Intronic
1083421599 11:62556403-62556425 GGCCTGAGTCACTGCAGCAAGGG - Intergenic
1085010508 11:73137786-73137808 GTCCCGAGTGACCAGAGCAGGGG + Intronic
1085532634 11:77201049-77201071 AGCCCGTGTGACCAGAGCACAGG + Intronic
1089878595 11:121751224-121751246 GGCCCCAGTGCCTACAGCAGCGG + Intergenic
1093913858 12:24777945-24777967 ACCCCGAGTGAGCTCAGCAAAGG - Intergenic
1096463723 12:51836945-51836967 GGCCAGAGAGACCACAGGAGGGG - Intergenic
1096811265 12:54171854-54171876 GGCCCGAGTGACCACAGCAATGG - Intronic
1097690405 12:62729287-62729309 GGCAAGTGTGGCCACAGCAAAGG + Intronic
1099191922 12:79569886-79569908 GGCCCCAGTGGCCACAGCCTGGG - Intergenic
1103373955 12:120440560-120440582 GGCACCAGGGACCACAGCACTGG + Exonic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1103927036 12:124429005-124429027 GGCCCCAGTGACGGCAGCCAGGG + Intronic
1104595532 12:130117780-130117802 GGCCAGAGTGATCCCAGGAAGGG + Intergenic
1105780479 13:23701779-23701801 GCCCCCAGAGACCACAGCCAGGG + Intergenic
1113771439 13:112911588-112911610 AGCCCGGGTGACCACAGCAGGGG - Intronic
1117257866 14:53998786-53998808 GGCCCCAGGGACACCAGCAATGG - Intergenic
1117863184 14:60114767-60114789 GTCCCAAGTGCCCACAGAAAGGG - Exonic
1119666814 14:76490882-76490904 GGCCCCAGTGACCATAGCCTGGG - Intronic
1121415663 14:93777726-93777748 GGCCTGAGAGAACACAGAAATGG - Intronic
1122744833 14:103891479-103891501 GGCCGGAGTGACACCAGCAATGG - Intergenic
1128753304 15:70164121-70164143 GGCTCCTGGGACCACAGCAAAGG - Intergenic
1129117331 15:73371848-73371870 GGCCCTGGGGACCCCAGCAAGGG + Intergenic
1132582105 16:689607-689629 GTCCCGTGTGACCACAGCCCTGG - Exonic
1132743437 16:1427253-1427275 GGCCTGAGGCCCCACAGCAAGGG + Intergenic
1136412286 16:30084538-30084560 GGCCCGTGGGACCAGAGCATGGG - Intronic
1136782632 16:32917022-32917044 GGCACTGGAGACCACAGCAAAGG - Intergenic
1136887162 16:33936828-33936850 GGCACTGGAGACCACAGCAAAGG + Intergenic
1137396965 16:48123026-48123048 TTCCCCAGTGACCACAGCCAGGG + Intronic
1138643714 16:58407131-58407153 GGCCCGAGTGACAGCACCACAGG - Intergenic
1139698969 16:68695542-68695564 GGCCAAAGAGACTACAGCAATGG - Intronic
1203085290 16_KI270728v1_random:1181010-1181032 GGCACTGGAGACCACAGCAAAGG - Intergenic
1144730281 17:17522071-17522093 AGCCCCAGTGACCTCAGGAATGG - Intronic
1152460882 17:80441773-80441795 GGCCCCAGTGGCCCCAGCGAAGG + Intergenic
1154300285 18:13186006-13186028 GCCCCCAGAGCCCACAGCAAGGG - Intergenic
1156135576 18:34032820-34032842 GGCCCCAGTGATGGCAGCAATGG - Intronic
1157196292 18:45622796-45622818 GGCCTTAGAGACCACAGCAAAGG + Intronic
1157751375 18:50181642-50181664 TGCCCAAGTGACCACCCCAAAGG + Intronic
1158135140 18:54199646-54199668 GCCCCAAGTGACCAAAGCCAGGG + Intronic
1162833880 19:13303567-13303589 GGCCAGATTGTCCACAGCGATGG + Exonic
1165291188 19:34887640-34887662 GTCCCGGGTGGCCACAGAAAAGG + Intergenic
1167311050 19:48738330-48738352 GCCCCAAGAGACCACATCAAAGG + Intronic
925799754 2:7586549-7586571 GGTCCCAGTGAAAACAGCAATGG - Intergenic
929035644 2:37688874-37688896 GGCCCAAGAAACCACAGAAAAGG - Intronic
932546145 2:72712427-72712449 GGTGAGAGAGACCACAGCAATGG - Intronic
936006199 2:108891544-108891566 GGCCCTAGTGATGACAGCAATGG + Intergenic
936152635 2:110030076-110030098 GGCCAGAGGCACCACAGAAATGG + Intergenic
936192045 2:110341336-110341358 GGCCAGAGGCACCACAGAAATGG - Intergenic
936558220 2:113514334-113514356 GGCTTCAGTGACCACAGCCAAGG + Intergenic
937088746 2:119190686-119190708 GCCCCGACTGCCCACAGCAATGG + Intergenic
938144309 2:128821190-128821212 GGCCCAAGTGCCCACAGGAGTGG - Intergenic
947907451 2:233775678-233775700 GGCCCAAGCAGCCACAGCAATGG - Exonic
948018703 2:234712492-234712514 TGACCTACTGACCACAGCAAGGG + Intergenic
948596892 2:239085355-239085377 TGTCCGAATGACCACAGAAACGG + Intronic
1169391746 20:5196416-5196438 TGCCCGGGAGACCACTGCAAAGG - Exonic
1170315394 20:15035606-15035628 AGCCTCAGTGACCATAGCAAGGG - Intronic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1170791500 20:19512762-19512784 GGACCGAGGGAGCACAGGAAAGG - Intronic
1173199939 20:40946955-40946977 GGCCCAAGTCACCACAGACAAGG + Intergenic
1175312403 20:58020845-58020867 GGCCCGAGTGACCACGGGGAAGG + Intergenic
1177832149 21:26150973-26150995 TGGCCGACTGACCACAGAAACGG + Intronic
1179891096 21:44335449-44335471 TGGCCCAGTGAACACAGCAATGG + Intronic
1180103550 21:45601736-45601758 GTCCCCAGGGCCCACAGCAAGGG + Intergenic
1180937873 22:19637892-19637914 GGCCCGAGGGACCCCAGGGAAGG + Intergenic
1182369369 22:29800135-29800157 GGCCATAGTGAGCACAGCAAAGG - Intronic
1182712550 22:32331875-32331897 GCCCCGAGAGACCACTGCAATGG - Intergenic
1183742967 22:39678606-39678628 GCCCCCAGTGCCCCCAGCAAGGG + Intronic
1184399796 22:44267257-44267279 GCCCCGAGAGACCACTGCAATGG - Intronic
1184746308 22:46458210-46458232 GGCCAGAGTGACCTCAGCCTGGG + Intronic
1184913146 22:47549424-47549446 GACCCGAGTGCCCACATCCATGG - Intergenic
949311033 3:2698458-2698480 GCTCAGAGTGACCACAGCGAAGG + Intronic
949587292 3:5454367-5454389 GGTACGAGTCACCCCAGCAAAGG + Intergenic
949887388 3:8707066-8707088 GGCCCCAGAGACCAGAGCAGGGG - Intronic
950096298 3:10332753-10332775 GGCCAGGGTGACCACAGCAAGGG - Intronic
950612361 3:14134536-14134558 AGTCAGAGTGACCACAGCACTGG - Intronic
953393082 3:42545218-42545240 GGCCCCAGGGATCAGAGCAAGGG - Intergenic
954916015 3:54149235-54149257 GGCCCTAATCACTACAGCAAGGG + Intronic
955645458 3:61132687-61132709 GTCCACAGTGACCACAGCACAGG + Intronic
960913609 3:122674912-122674934 TGCCCGAGAGATCACATCAAAGG + Intergenic
961362395 3:126376127-126376149 GGCAGGAGTGACCACAGCAGTGG + Intergenic
961452471 3:127008643-127008665 AGGCGGAGTGTCCACAGCAAAGG - Intronic
971329636 4:25671907-25671929 GGCCTGAGGTCCCACAGCAAGGG + Intronic
973317674 4:48779453-48779475 GGGCGGAGAGACCAGAGCAAGGG + Intronic
973633446 4:52840751-52840773 GGCCAGAGTGATCAAAGGAAAGG - Intergenic
974039444 4:56845194-56845216 GGCCCCAGAGAGCACAGCAGAGG - Intergenic
977648804 4:99445378-99445400 GGCCCAGGTGATGACAGCAATGG - Intergenic
983331979 4:166341630-166341652 GGCTAGAGTGACCACATGAAAGG - Intergenic
985632381 5:1020814-1020836 GGGACGACTGACCACACCAAGGG - Intronic
985861162 5:2471643-2471665 GGCCCTAGTGACCAGGCCAAAGG + Intergenic
986722413 5:10569162-10569184 GGCCTGCGTGTGCACAGCAACGG + Intronic
986741683 5:10710598-10710620 GGCACGAGGGTCCACACCAATGG + Intronic
987110778 5:14684530-14684552 GGCCAGAGTGAGAACAGGAATGG - Intronic
987299194 5:16581615-16581637 GGCACTTGTGACCACATCAATGG + Intronic
995639487 5:114238136-114238158 GGGCAGAGTGATCACAGTAAAGG + Intergenic
997860104 5:137408429-137408451 GGCAGGAATGATCACAGCAAAGG - Intronic
998229056 5:140347660-140347682 GGCCAGACTGACCCCTGCAAAGG - Intergenic
1001987355 5:176086034-176086056 TGACCAACTGACCACAGCAAGGG - Intronic
1002229513 5:177752108-177752130 TGACCAACTGACCACAGCAAGGG + Intronic
1002265832 5:178031665-178031687 TGACCAACTGACCACAGCAAGGG - Intronic
1002329672 5:178432876-178432898 AGTCCTAGTGACCACTGCAAGGG - Intronic
1002586101 5:180249370-180249392 GGCCTGCGAGACCACAGAAAGGG - Intronic
1003485985 6:6580010-6580032 GGCTGGAGTGCCCACAGCCAGGG + Intergenic
1006843271 6:37045212-37045234 GGCACCAGGGACCACAGCACTGG + Exonic
1012765223 6:103358280-103358302 GGCCTCAGTAATCACAGCAATGG - Intergenic
1014541466 6:122680987-122681009 GGTCAGTGTGGCCACAGCAAAGG - Intronic
1018356141 6:163019649-163019671 GACCCATGTGACCACAGCAACGG - Intronic
1018940980 6:168308712-168308734 GGGCCGGGAGACCCCAGCAAAGG - Exonic
1018964885 6:168477179-168477201 GGCTGGAGTGTCCACAGGAAAGG - Intronic
1020022888 7:4879545-4879567 GGTCCCAGTGAACACAGCACGGG + Intronic
1021111547 7:16700039-16700061 GGCCCCAGGGAACACAGGAAGGG + Intronic
1023564587 7:41511164-41511186 GGCCAGAGTGACCATAGGATGGG - Intergenic
1026582718 7:71631633-71631655 GGCCGGAGTGGCATCAGCAAAGG + Intronic
1026980869 7:74525993-74526015 GGCCAGGGTGGCCACATCAAAGG - Intronic
1028722594 7:94050585-94050607 GGCCCAAGGGCCCACACCAAAGG - Intergenic
1029438674 7:100575859-100575881 GCCCCAACTGACCACAGCAGGGG + Exonic
1029881068 7:103810318-103810340 GGCCCGAGTGACAAAAGGATGGG - Intronic
1030929596 7:115505676-115505698 GGACCTAGGGACCGCAGCAAAGG - Intergenic
1037148278 8:15601354-15601376 GGCCCAAGTGTCTAAAGCAACGG + Intronic
1038704449 8:29880634-29880656 GGCCCAAGTGACACCAGCCATGG + Intergenic
1040555077 8:48471226-48471248 GGCCAGACTGACCAAAGCAAGGG - Intergenic
1045190027 8:99872722-99872744 GGACTGAGTGGCCCCAGCAAAGG + Intronic
1045202578 8:99999685-99999707 ATCCTGTGTGACCACAGCAATGG + Intronic
1049758450 8:144321103-144321125 CACCCAAGTGACCACAGCAGGGG + Intronic
1050152083 9:2627046-2627068 GGACAGAGTGACCATAGCACTGG + Intronic
1052817642 9:33113972-33113994 GGGCTGAGTGAGAACAGCAAGGG - Intronic
1053271083 9:36749951-36749973 GGCCCTGGTGACCACATCACAGG + Intergenic
1057686342 9:97238178-97238200 GGTCCGAGTGACCGCAGCAGTGG + Intergenic
1061068201 9:128292290-128292312 CACCAGAGTGACCACAGCAGGGG + Intergenic
1061431411 9:130533633-130533655 GGCAGGAGGGACCACAGCCAGGG - Intergenic
1186260944 X:7778867-7778889 GGTCCAAGTGATCACTGCAATGG - Intergenic
1190328675 X:49222557-49222579 GGCCAGGTTGTCCACAGCAATGG + Exonic
1192559503 X:72116768-72116790 GGCCCCAGTGAGGACAGCTAGGG + Intergenic
1192790176 X:74373867-74373889 GGCACTGGTGCCCACAGCAAAGG + Intergenic
1194111770 X:89842508-89842530 TGACCAGGTGACCACAGCAATGG + Intergenic
1195803226 X:108735477-108735499 GCTCCGAGTGTCCACAGCGACGG + Exonic
1200464431 Y:3497298-3497320 TGACCAGGTGACCACAGCAATGG + Intergenic