ID: 1096811541 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:54173549-54173571 |
Sequence | GGCTCGGCGGCGGGCCGCGC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 599 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 26, 4: 569} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096811541_1096811550 | 8 | Left | 1096811541 | 12:54173549-54173571 | CCCGCGCGGCCCGCCGCCGAGCC | 0: 1 1: 0 2: 3 3: 26 4: 569 |
||
Right | 1096811550 | 12:54173580-54173602 | TCTCCAGCCTCATCGCCGCGCGG | 0: 1 1: 0 2: 0 3: 3 4: 86 |
||||
1096811541_1096811553 | 13 | Left | 1096811541 | 12:54173549-54173571 | CCCGCGCGGCCCGCCGCCGAGCC | 0: 1 1: 0 2: 3 3: 26 4: 569 |
||
Right | 1096811553 | 12:54173585-54173607 | AGCCTCATCGCCGCGCGGGCTGG | 0: 1 1: 0 2: 0 3: 5 4: 57 |
||||
1096811541_1096811551 | 9 | Left | 1096811541 | 12:54173549-54173571 | CCCGCGCGGCCCGCCGCCGAGCC | 0: 1 1: 0 2: 3 3: 26 4: 569 |
||
Right | 1096811551 | 12:54173581-54173603 | CTCCAGCCTCATCGCCGCGCGGG | 0: 1 1: 0 2: 0 3: 6 4: 138 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096811541 | Original CRISPR | GGCTCGGCGGCGGGCCGCGC GGG (reversed) | Intronic | ||