ID: 1096811541

View in Genome Browser
Species Human (GRCh38)
Location 12:54173549-54173571
Sequence GGCTCGGCGGCGGGCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 569}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096811541_1096811550 8 Left 1096811541 12:54173549-54173571 CCCGCGCGGCCCGCCGCCGAGCC 0: 1
1: 0
2: 3
3: 26
4: 569
Right 1096811550 12:54173580-54173602 TCTCCAGCCTCATCGCCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 86
1096811541_1096811553 13 Left 1096811541 12:54173549-54173571 CCCGCGCGGCCCGCCGCCGAGCC 0: 1
1: 0
2: 3
3: 26
4: 569
Right 1096811553 12:54173585-54173607 AGCCTCATCGCCGCGCGGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 57
1096811541_1096811551 9 Left 1096811541 12:54173549-54173571 CCCGCGCGGCCCGCCGCCGAGCC 0: 1
1: 0
2: 3
3: 26
4: 569
Right 1096811551 12:54173581-54173603 CTCCAGCCTCATCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096811541 Original CRISPR GGCTCGGCGGCGGGCCGCGC GGG (reversed) Intronic