ID: 1096813873

View in Genome Browser
Species Human (GRCh38)
Location 12:54189232-54189254
Sequence TGGAAGGGCGATGCCCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096813873_1096813880 18 Left 1096813873 12:54189232-54189254 CCCTAAAGGGCATCGCCCTTCCA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1096813880 12:54189273-54189295 TCCCAAAGGGATTGCAAATCAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1096813873_1096813878 4 Left 1096813873 12:54189232-54189254 CCCTAAAGGGCATCGCCCTTCCA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1096813878 12:54189259-54189281 TTCATTCACTATTTTCCCAAAGG 0: 1
1: 0
2: 1
3: 21
4: 338
1096813873_1096813879 5 Left 1096813873 12:54189232-54189254 CCCTAAAGGGCATCGCCCTTCCA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1096813879 12:54189260-54189282 TCATTCACTATTTTCCCAAAGGG 0: 1
1: 0
2: 1
3: 25
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096813873 Original CRISPR TGGAAGGGCGATGCCCTTTA GGG (reversed) Intergenic
900850553 1:5139300-5139322 TGGATGGGCGTTGTCCTTGATGG + Intergenic
900972675 1:6000185-6000207 TGGAAAGGCAATACCCTCTAGGG - Intronic
902253170 1:15169535-15169557 TGGAAGGGCGATCAGCTTTTGGG - Intronic
904037850 1:27568472-27568494 TGGAAGGGCGAGGCCTTCAACGG + Intronic
909533432 1:76707034-76707056 TGGAAAGGCCAGGCCCTTTGTGG - Intergenic
915956647 1:160225805-160225827 TGGAAAAGGGATGCCCTTTAAGG - Intronic
916252868 1:162755403-162755425 TGGAATGGTGATGCCCTCTTGGG + Intronic
919253948 1:195096996-195097018 TGGAAAGGAGCTGCCCTCTATGG + Intergenic
1063053799 10:2481325-2481347 TGGAAGGGCATTGGCTTTTAGGG - Intergenic
1069752381 10:70752706-70752728 AGGATGGGCGATGCCCTCTGTGG - Intronic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1079923972 11:26469130-26469152 AGGAAGGGAGATTCCTTTTAGGG - Intronic
1096813873 12:54189232-54189254 TGGAAGGGCGATGCCCTTTAGGG - Intergenic
1100612720 12:96204942-96204964 TGAAAGGGCTATGCCCTGGAAGG + Intronic
1101280008 12:103243857-103243879 TGGAAGGAAGATGTCCTTTAGGG + Intronic
1109020409 13:57083658-57083680 TGGAAGGGTGTTTCTCTTTAAGG - Intergenic
1126548606 15:49902057-49902079 TGGAAAGATGATGCCCTTAAAGG + Intronic
1127519199 15:59726666-59726688 TGGAAGGTGAATGCCCATTAAGG + Intergenic
1130108339 15:80945512-80945534 TGGTAGGGTGAGGCCCCTTAAGG - Intronic
1142573800 17:893094-893116 TGGAACAGCTTTGCCCTTTAGGG - Intronic
1143120334 17:4602702-4602724 TGGAAGGTGGGTGCCCTTGAAGG + Intronic
1147549396 17:41428759-41428781 TGGCAGGGAGAGGCCCTCTAAGG - Intergenic
1152462136 17:80447025-80447047 TCCAAGGGCGAGGCCCTTTTGGG - Intergenic
926322332 2:11757652-11757674 GGGAGGGACCATGCCCTTTAAGG - Intronic
927130025 2:20051284-20051306 TGGAGGGGCGCTGCTTTTTAAGG - Intronic
929765475 2:44840537-44840559 TGGAAGGTGGATGCATTTTAAGG + Intergenic
938180609 2:129178960-129178982 TGGAAGGGAGATGCCCCCTGAGG - Intergenic
938619292 2:133032223-133032245 GGGAAGGGCAATGCCCTGAAGGG + Intronic
941356697 2:164502672-164502694 GGGAAGGGCGATGTGCTTTCTGG + Intronic
1169609088 20:7359142-7359164 TGGGAGGGCGCTGCACATTATGG + Intergenic
1175938514 20:62526336-62526358 TGGAAGGGCCATGTCCCTTTTGG + Intergenic
1178426618 21:32484025-32484047 TGGAAAGTCAATGCCCTTGAGGG - Intronic
1179018755 21:37618125-37618147 TGTCAGGGCGATGCCCGTGATGG + Exonic
950153094 3:10703510-10703532 TGGAAGAGAGATGCTATTTATGG + Intronic
950746350 3:15092899-15092921 TGGAAGGGCTATGTCCTTTCTGG - Intronic
952493891 3:33899106-33899128 TGGAAGGGAGAGGCTTTTTATGG + Intergenic
959816665 3:110681781-110681803 TGGAAGGGAGAGTCACTTTAAGG - Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
1001254296 5:170171819-170171841 TGGCATGGCGATGGCCATTAAGG + Intergenic
1001572251 5:172737705-172737727 TGGAAGTACTATGCCCTGTAGGG + Intergenic
1004002304 6:11606558-11606580 GGGAAGGAAGCTGCCCTTTAAGG + Intergenic
1014703163 6:124714748-124714770 TGGAAGGGCTATTCCCTTCTGGG + Intronic
1017549428 6:155489369-155489391 TTGAACTGCAATGCCCTTTAAGG - Intergenic
1022202109 7:28126852-28126874 TGGAAAGGAGATGACCTTTAGGG - Intronic
1035677232 8:1464273-1464295 TGGAAGGGCGTTGTCCTGGAAGG - Intergenic
1035677241 8:1464305-1464327 TGGAAGGGCGTTGTCCTGGAAGG - Intergenic
1035677255 8:1464353-1464375 TGGAAGGGCGTTGTCCTGGAAGG - Intergenic
1036750841 8:11443050-11443072 TGGAAGGCAGCTGCCCTTGATGG + Intronic
1039848565 8:41343307-41343329 CGGAAGGGCGCTCCCCTTCAGGG + Intergenic
1040301566 8:46190721-46190743 GGGATGGGAGATGCCTTTTAGGG - Intergenic
1041619557 8:59950647-59950669 TGGAATTGAGATGCCCATTAAGG - Intergenic
1044900770 8:96942149-96942171 TGGAAGGGCAATGCTATTTCAGG - Intronic
1050361336 9:4834024-4834046 TGGAAGAGCTATGCCTTGTAAGG + Intronic
1062265290 9:135684072-135684094 TAGAAGGGCCAGCCCCTTTAAGG - Intergenic
1190165685 X:48071326-48071348 TGGAAGGGAAATGGCCTTTCGGG - Exonic