ID: 1096814167

View in Genome Browser
Species Human (GRCh38)
Location 12:54191251-54191273
Sequence CAGCCAATGTCAGAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096814157_1096814167 26 Left 1096814157 12:54191202-54191224 CCAGATATAAGGAGAAACTGAGG 0: 1
1: 0
2: 4
3: 38
4: 289
Right 1096814167 12:54191251-54191273 CAGCCAATGTCAGAGGGGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 218
1096814160_1096814167 -6 Left 1096814160 12:54191234-54191256 CCCACAGTGAGTCCCTACAGCCA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1096814167 12:54191251-54191273 CAGCCAATGTCAGAGGGGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 218
1096814161_1096814167 -7 Left 1096814161 12:54191235-54191257 CCACAGTGAGTCCCTACAGCCAA 0: 1
1: 0
2: 2
3: 18
4: 143
Right 1096814167 12:54191251-54191273 CAGCCAATGTCAGAGGGGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096814167 Original CRISPR CAGCCAATGTCAGAGGGGCC TGG Intergenic
900094229 1:933890-933912 CAGCCCAGGTCAGGGGAGCCGGG + Intronic
900367463 1:2317057-2317079 CTGCTAATGCCAAAGGGGCCTGG + Intergenic
900552759 1:3264776-3264798 CAGCCAAGGGCAGAGGGGCTTGG + Intronic
900555590 1:3278806-3278828 CAGGGAACGTCAGAGGGGACGGG + Intronic
900581810 1:3413206-3413228 CTGCAGAAGTCAGAGGGGCCTGG + Intronic
900616458 1:3567718-3567740 CAGCCAGGGGCAGGGGGGCCTGG + Intronic
901045179 1:6392001-6392023 GAGCCAAAGTCAAAGGGGCAGGG + Intronic
901807960 1:11749719-11749741 AAGCCCATGGCACAGGGGCCAGG + Intronic
902245436 1:15117679-15117701 CTCCCCAGGTCAGAGGGGCCTGG - Exonic
902301390 1:15505130-15505152 CTGCCTCAGTCAGAGGGGCCTGG - Intronic
902678396 1:18025398-18025420 GAGTCAATGTCAGAGAGGCCTGG - Intergenic
903058973 1:20656230-20656252 CTGCCAGTGTCAGAGGAGCAGGG - Intronic
903545204 1:24119626-24119648 CAGGCAAAGCCAGAGGGGTCTGG - Intergenic
904773418 1:32893429-32893451 CAGCAAACGTCAGAGAGCCCGGG + Intronic
905227192 1:36486952-36486974 CAGCTTGTTTCAGAGGGGCCGGG + Intergenic
905288627 1:36905925-36905947 CTGCCAAGGTCTGAGAGGCCAGG - Intronic
906374303 1:45282189-45282211 CAGCAAATGTAAGAGGTGCTGGG - Intronic
908934860 1:69362852-69362874 CACCTAAGGTCAGAGGTGCCTGG - Intergenic
909571530 1:77117560-77117582 CACCCAATCTCTGAGGTGCCTGG + Intronic
912163848 1:107019114-107019136 GAGCCCATCTCAGAGGGGCAAGG + Intergenic
912302655 1:108533962-108533984 CAGCCAAGGTTGGAGGGGCCAGG + Intergenic
915972947 1:160366932-160366954 CAGCCATTGGCAGAGGGATCTGG - Intergenic
916193821 1:162204514-162204536 CAGCCAGTGTCAGAGTGGTGTGG + Intronic
917678038 1:177338896-177338918 CAGCCATTGGTTGAGGGGCCAGG + Intergenic
918072483 1:181143092-181143114 CAGCAGATGTCACAGAGGCCTGG - Intergenic
920817123 1:209345133-209345155 CAGGCAACGTCAGAGAGTCCTGG - Intergenic
922039995 1:221887248-221887270 CAGCCAGTGTCACATGGTCCTGG - Intergenic
923119009 1:230972914-230972936 CTGGCAATGCCACAGGGGCCAGG + Intronic
923210202 1:231797008-231797030 CAGAAAATGTAAGAGAGGCCAGG - Intronic
923355403 1:233150081-233150103 CAGCCACAGCCAGCGGGGCCAGG + Intronic
923464423 1:234235493-234235515 GTTCCAAGGTCAGAGGGGCCAGG - Intronic
924106534 1:240654614-240654636 CTGTCCATGTCAGTGGGGCCTGG - Intergenic
1064243179 10:13648676-13648698 CAGCCGATGTCACTGGAGCCCGG - Intronic
1065123440 10:22550325-22550347 CAGCCAGTTTGGGAGGGGCCAGG - Intronic
1065903394 10:30227645-30227667 CGGCCAATATCAGAGGAGCTGGG - Intergenic
1065903549 10:30228724-30228746 CTGCCAATATCAGAGGAGCTGGG - Intergenic
1066252093 10:33644219-33644241 CCTCCAGTGTCAGAGGAGCCTGG + Intergenic
1066429452 10:35337258-35337280 CAGCCAACGTCGGGGCGGCCCGG + Intronic
1067478844 10:46582719-46582741 GAGCCAGTTTCACAGGGGCCTGG + Intronic
1067615894 10:47759082-47759104 GAGCCAGTTTCACAGGGGCCTGG - Intergenic
1068100226 10:52543324-52543346 CAGCTCATGTCAGAGCCGCCTGG + Intergenic
1068221839 10:54055620-54055642 CAGCTAATATCAGAGGTGTCTGG - Intronic
1069875912 10:71562707-71562729 GAGACAAAGTCAGCGGGGCCTGG + Intronic
1071136329 10:82458378-82458400 CAGACATTTTCAGAGGTGCCAGG + Intronic
1073797028 10:106999939-106999961 CAGCAGATGTCAGCTGGGCCAGG + Intronic
1074868889 10:117561709-117561731 CAGCCACTGCCAGAGGAGACTGG - Intergenic
1075668256 10:124245781-124245803 CAGCCAATGGCAGAGGGAGGAGG - Intergenic
1076421471 10:130335238-130335260 CAGCCAAGGACTGAGGGACCAGG - Intergenic
1076686562 10:132200811-132200833 AAGCCAGGGTCAGAGGGTCCTGG - Intronic
1077515955 11:3002363-3002385 CACCCCATGTGAGAAGGGCCTGG + Intronic
1081849456 11:46265104-46265126 AAGCCAATCTCGGAGGGGCGAGG + Intergenic
1081873285 11:46392627-46392649 CAGCCAATCTCAGAGGTCGCTGG + Intergenic
1083988258 11:66230965-66230987 CAGGGAATCTCAGAGGGTCCTGG - Intronic
1084578812 11:70009401-70009423 CAGCAGATGTCAGAGGCCCCAGG - Intergenic
1084600328 11:70141677-70141699 CAGCCAGTGTGAAAAGGGCCCGG - Intronic
1084731433 11:71076108-71076130 CACCCAAGCTCACAGGGGCCAGG + Intronic
1087363045 11:97184882-97184904 CAGCCAATGTCTTAGGAGACTGG - Intergenic
1089211369 11:116805672-116805694 GAGGCAATGTCAGACGGGCACGG + Intergenic
1089497099 11:118913459-118913481 CAGTCATTGTCAGTGTGGCCGGG + Intronic
1089580700 11:119480427-119480449 CTGGAAATGTCAGAGGGCCCTGG + Intergenic
1090458436 11:126869229-126869251 CAGCCAATGACAGAGGGAGGTGG + Intronic
1090986354 11:131769909-131769931 CTGCCAATGAAAGAAGGGCCTGG - Intronic
1091098473 11:132846384-132846406 CAGATAATGTCAGAGTGGCTGGG + Intronic
1091669472 12:2442535-2442557 CACCCACTGTCAGAGGAGCAGGG + Intronic
1092153712 12:6268609-6268631 CAGCTGAGGTCAGAGGGGACAGG + Intergenic
1093785479 12:23187584-23187606 CAGCCCAGATCAGAGGAGCCAGG + Intergenic
1096814167 12:54191251-54191273 CAGCCAATGTCAGAGGGGCCTGG + Intergenic
1101013589 12:100476171-100476193 TAGCCAATATCAGAGTAGCCAGG - Intronic
1102456984 12:113077177-113077199 CAGCCAGGGTGAGGGGGGCCGGG - Intronic
1104745142 12:131205734-131205756 CCTGCAATGTCAGAGGGACCTGG - Intergenic
1104878505 12:132053330-132053352 CAGCCAGAGCCTGAGGGGCCAGG - Exonic
1104885964 12:132108448-132108470 CAGCCACTAACAGAGGGGCACGG - Intronic
1104898731 12:132176554-132176576 AAGTCAGTGTCAGAGGGGACAGG - Intergenic
1105451541 13:20504135-20504157 CAGCCTAAGTCAGGGCGGCCTGG + Intronic
1113567367 13:111326999-111327021 CAGCCAGGCTCAGAGGGGCCTGG - Intronic
1113578974 13:111414588-111414610 CAGCCACGGTCAGAGGGGGCAGG - Intergenic
1113815941 13:113171270-113171292 CAGCCAATGTTTGACTGGCCTGG + Intronic
1122016348 14:98800093-98800115 CAGCCAAGGGGAGTGGGGCCAGG - Intergenic
1122707887 14:103632859-103632881 CAGCCAGTGTCAGGGGGTCAGGG + Intronic
1122985765 14:105210923-105210945 CAGCCAGGGTCAGAGAGGCTAGG - Intronic
1124627090 15:31314386-31314408 GAGACTGTGTCAGAGGGGCCAGG + Intergenic
1128231113 15:66036080-66036102 CAGGCACAGCCAGAGGGGCCAGG + Intronic
1128582855 15:68820983-68821005 CAGCCAATGGCAGTGGCGGCGGG + Intronic
1129301245 15:74626793-74626815 AAGCCACTGTCAGAAGGGGCTGG + Intronic
1129536812 15:76319871-76319893 CAGCAAATGCCAGAGGGGTGAGG - Intergenic
1129993902 15:79988463-79988485 CTCCCAATGCCAGTGGGGCCAGG + Intergenic
1130048505 15:80464423-80464445 CAGGGATTGTCAGAGGTGCCGGG + Intronic
1131055442 15:89371901-89371923 CAGCCAAAGTCAGAGCGGGATGG - Intergenic
1132616725 16:844705-844727 CAGCCCAGGTCAGAGGCGGCAGG - Intergenic
1133063738 16:3191758-3191780 CAGCCAGGGGCAGAGGGGCGGGG + Intergenic
1133130516 16:3673719-3673741 CAGCCAAGGACAGAAGAGCCTGG + Intronic
1134137454 16:11687517-11687539 CAGGCAATGCCAGTGGGTCCTGG - Intronic
1134195301 16:12155061-12155083 CAGCCACTGGCAGAAGGGCAAGG - Intronic
1134238884 16:12489478-12489500 CAGCCAGTGTGGGAGGGGGCAGG - Intronic
1136233412 16:28900909-28900931 CAGCCATGGTGAGAGGGCCCAGG + Exonic
1137725425 16:50653555-50653577 CAGCCAAGGTGAGCCGGGCCTGG - Intergenic
1139727910 16:68916702-68916724 CTGACTATGTCAGAGGGTCCTGG - Intronic
1139949807 16:70663343-70663365 CTGCCCATGACAGAGGGGCCAGG - Exonic
1140919979 16:79528389-79528411 CAGACACTGTCCCAGGGGCCAGG + Intergenic
1141267335 16:82508901-82508923 CAGGCAATGCAAGAAGGGCCAGG - Intergenic
1141684455 16:85562325-85562347 CAGCCCTTTTCCGAGGGGCCTGG + Intergenic
1142264757 16:89058554-89058576 CTGCCACTGGCAGAGGGGTCTGG + Intergenic
1142266609 16:89066869-89066891 CAGCCAGGATCAGAGGGACCAGG - Intergenic
1142644500 17:1303084-1303106 CAGCCAATGCCTGAAAGGCCTGG - Intergenic
1144787686 17:17840838-17840860 CAGGTTATGGCAGAGGGGCCAGG + Intergenic
1145274984 17:21423789-21423811 CAGCTAATGCCAGAGGTGCTGGG + Intergenic
1145312838 17:21709689-21709711 CAGCTAATGCCAGAGGTGCTGGG + Intergenic
1146142302 17:30378847-30378869 CAGCCAATCGCGGACGGGCCTGG - Intergenic
1146551502 17:33784032-33784054 CAACCAAGCTCAGGGGGGCCTGG + Intronic
1147916742 17:43892194-43892216 CAGACAGTGTAGGAGGGGCCAGG - Intronic
1148392888 17:47285938-47285960 CAACCTATGAAAGAGGGGCCAGG - Intronic
1148424215 17:47577908-47577930 AAAAGAATGTCAGAGGGGCCAGG + Intronic
1148605817 17:48928161-48928183 TAGCCAATGGCAGAGGGGGTTGG + Exonic
1151185666 17:72362162-72362184 CAGCCATATTCAGAGGAGCCGGG + Intergenic
1151942038 17:77298740-77298762 CACCCAAAGTGAGAGAGGCCAGG - Intronic
1152091447 17:78249837-78249859 CAGGCAGAGTCAGAGGGGCCAGG + Intergenic
1152379865 17:79936834-79936856 CAGCCTAAGTCAGTGGAGCCAGG - Exonic
1153165900 18:2261976-2261998 CAGGCAATGTTCGAGGGGCAGGG - Intergenic
1153733846 18:8044065-8044087 CAGGCACTCTCAGAGGGGCTAGG + Intronic
1157933521 18:51849226-51849248 CAGCCTATGACAGAGGGACAGGG - Intergenic
1158405724 18:57157596-57157618 CAACCAATGCCAGAGGGACCTGG - Intergenic
1160573453 18:79834161-79834183 CAGCCAGCGTCAGAGCGGCTTGG + Intergenic
1160662315 19:306821-306843 CAGCCTATGGCAGCCGGGCCCGG + Intronic
1160785030 19:896402-896424 CAACCAAGGGCAGAGGAGCCAGG + Intergenic
1162043765 19:7985598-7985620 GAGCCAAGCTCAGAGGGGCCTGG + Intronic
1163723603 19:18910177-18910199 CAGCCAAGGGGAGAGGGGGCTGG - Intronic
1164931358 19:32178598-32178620 CAGCCAATCCCAGACGTGCCAGG + Intergenic
1165701661 19:37942854-37942876 CAGCCCATGTTAAAGGGGACTGG - Intronic
1166749229 19:45156802-45156824 CAGCCACTTTCAGAGAGGCCTGG + Intronic
1168712925 19:58512054-58512076 CAGCCACTGTCAGCAGTGCCAGG - Exonic
925086420 2:1111388-1111410 CTGCAAAGGTAAGAGGGGCCCGG - Intronic
925607549 2:5673784-5673806 GAGCCAAAAACAGAGGGGCCGGG + Intergenic
925630004 2:5882250-5882272 CAGGGCATGTCTGAGGGGCCAGG - Intergenic
926090877 2:10048401-10048423 CAGCCAATGTCATGGCTGCCGGG + Exonic
928584964 2:32750248-32750270 CAGCAAATGTCTCAGGGGCCTGG + Intronic
929263617 2:39894308-39894330 CAGCCAATATCAGAGAGCTCCGG + Intergenic
931628070 2:64274912-64274934 CAGCCGAGGTCAGAGGCCCCAGG - Intergenic
934561390 2:95315341-95315363 AAGCAAATGCCAGAGGAGCCAGG + Intronic
935187126 2:100744598-100744620 CAGCCAGTTTCAGAGGGGCATGG - Intergenic
936092869 2:109512212-109512234 CAGCAAAGGACAGTGGGGCCAGG - Intergenic
938320142 2:130356751-130356773 AAGCCGAGGTCAGAGGGGCCAGG - Intronic
938647058 2:133342503-133342525 GAGCCAGAGTCAGAGAGGCCTGG + Intronic
938663429 2:133510047-133510069 CAGGCAGTGTCAGAGGAGGCAGG + Intronic
941654981 2:168133569-168133591 AAGAAAATGACAGAGGGGCCAGG + Intronic
945448038 2:209961185-209961207 CAGCAAGAGTCAGAGAGGCCTGG + Intronic
945854607 2:215053789-215053811 CAGCCACTGTCTTAGGGGCTGGG - Intronic
947097459 2:226582284-226582306 CAGGCTAGGTCAGAGGGGCCAGG + Intergenic
947734704 2:232448595-232448617 CTGCCACTGTCAGATGGGGCTGG + Intergenic
947787806 2:232839902-232839924 CAGCCAACGACAGCGTGGCCTGG - Exonic
947877074 2:233474568-233474590 CAGCCATTGCCACAGGGACCTGG + Intergenic
1168859208 20:1033843-1033865 GAGTCAATGTGAGAGGGGCTTGG - Intergenic
1169475301 20:5925753-5925775 CAGACAAGATCTGAGGGGCCAGG - Intergenic
1170029433 20:11929687-11929709 CAGTGAAGGCCAGAGGGGCCAGG + Intergenic
1171140946 20:22742093-22742115 CAGGCCATGTCAGAAGGGGCTGG - Intergenic
1171986471 20:31664855-31664877 CTGCCAAGGCCAGAGTGGCCTGG - Exonic
1172193997 20:33079639-33079661 CAGCCAAAAGCAGAGGGGCTGGG + Intronic
1174359216 20:50017395-50017417 CAGCCAATGAGAGACAGGCCTGG + Intergenic
1175904045 20:62371193-62371215 CAGCAAGTGGCAGAGGGGCCAGG - Intergenic
1176231137 20:64033506-64033528 CAGCACATGCCTGAGGGGCCCGG - Intronic
1176235161 20:64050458-64050480 CCGCCCAGGTCAGAGGGTCCAGG - Intronic
1179133387 21:38659436-38659458 CAGCCAATGCCAGCGGAGCAAGG + Intronic
1179153966 21:38833510-38833532 CAGCCAATGGGAGAGAGGGCTGG - Intergenic
1180129747 21:45819925-45819947 CAGCCATTGTCTGAAGGTCCAGG + Intronic
1181476073 22:23168563-23168585 CAGCAGATGGCAGAGGAGCCTGG - Intergenic
1181588232 22:23866256-23866278 CACCCAATGTCAGGGGAGGCTGG + Intronic
1183703283 22:39461822-39461844 CAGCCAGTGACAGAGGTTCCAGG + Intronic
1185342360 22:50297298-50297320 CAGCCAAGGTCAGGGGAGGCTGG + Intronic
949360741 3:3229595-3229617 CAGCCACTGTCACAGGGACTAGG - Intergenic
949559189 3:5187375-5187397 CAGCCAATGGGAGAGCGGCACGG - Intergenic
950090558 3:10291483-10291505 CAGTCAATGAGAGAGGAGCCAGG - Intronic
954465012 3:50649188-50649210 CAGCCAGTGAGAGAGGGGCCAGG - Exonic
954579094 3:51693375-51693397 CAGGGAATGGCAGAGGAGCCAGG - Intronic
955513081 3:59700621-59700643 CAGAGAATGTCAGAGAGGGCTGG - Intergenic
960969438 3:123129265-123129287 TATCCAATGTCAGATGGGACTGG - Intronic
961331825 3:126147129-126147151 CAGCCAGCATCAGAGGGCCCTGG - Intronic
967819216 3:193825755-193825777 GAGTCCATGACAGAGGGGCCTGG + Intergenic
969176343 4:5401981-5402003 CAGCCAAGGCCAGAGGGGATCGG - Intronic
970354267 4:15236598-15236620 CAGCCAATGGAAGAGGTGCATGG - Intergenic
977741430 4:100488063-100488085 TAGCTAATGTCAGAGTTGCCAGG - Intronic
978737003 4:112094741-112094763 CATCCAATGTCAGCAGGACCTGG - Intergenic
982463820 4:155705260-155705282 CAGAAAATGTAATAGGGGCCAGG + Intronic
985820712 5:2158192-2158214 CAGCTACTGTCAGAGGGGTTTGG + Intergenic
986349983 5:6868336-6868358 CAGCCAAGGTCAGAGGGGCTGGG - Intergenic
988487786 5:31680923-31680945 CAGCAATTGTCCGAGGGGCAAGG - Intronic
989105230 5:37857014-37857036 CACCCAATGACAAGGGGGCCAGG - Intergenic
990049121 5:51473936-51473958 CTGCCAGTGGCAGAGGGGCATGG + Intergenic
992208270 5:74452252-74452274 CAGGCAGTGTCAGAGAAGCCAGG + Intergenic
992833057 5:80614344-80614366 CAGCCAATGTGAGATGGAGCTGG - Intergenic
996747471 5:126857662-126857684 CAGCCAATGCCAGGGAGGCCAGG - Intergenic
997354964 5:133256461-133256483 CAGCCAAAGTCACAAGGTCCGGG - Intronic
997582441 5:135026376-135026398 CTGCCAAGGCCAGAGGGCCCTGG - Intergenic
999249980 5:150176740-150176762 CAGCTAAAGTCAGTGGGTCCTGG - Intronic
999731307 5:154478289-154478311 GAGCCAATGGCAGGGGGGCGGGG + Intergenic
1003875958 6:10437007-10437029 CAAAGAATGTAAGAGGGGCCAGG - Intergenic
1005012250 6:21347299-21347321 CAGGCAAGGGCAGGGGGGCCTGG - Intergenic
1005510610 6:26508820-26508842 CTGCCAATGGGAGAGGGGTCCGG - Exonic
1006981907 6:38154103-38154125 CAACCCAGGGCAGAGGGGCCAGG + Exonic
1007049019 6:38806934-38806956 AACCCAGTCTCAGAGGGGCCGGG + Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007612665 6:43160539-43160561 CAGCCAGAGTGAGTGGGGCCAGG + Intronic
1007711164 6:43825362-43825384 CAGCCTTTCTCAGGGGGGCCCGG + Intergenic
1010654767 6:78499255-78499277 CAGCCAATGTCAGACTGAACAGG - Intergenic
1012155415 6:95813416-95813438 CAGCCATTGTCAGTGGGGGGTGG + Intergenic
1013091224 6:106902446-106902468 CATGCAATTTGAGAGGGGCCAGG + Intergenic
1021929145 7:25562247-25562269 CAGCCAAGGGCAAAGGTGCCAGG + Intergenic
1024959686 7:54960966-54960988 CAGCCATTGTCAGAGTGGATGGG + Intergenic
1026264528 7:68784631-68784653 CAGCCAAAGACCAAGGGGCCTGG - Intergenic
1026899189 7:74027736-74027758 CAGCCAAGGCCCGAGTGGCCAGG - Intergenic
1031240921 7:119238263-119238285 CAGCTGCTGTGAGAGGGGCCAGG - Intergenic
1033012794 7:137640343-137640365 CAGCCAAGGAGAGAAGGGCCAGG + Intronic
1033466652 7:141597104-141597126 CAGCCCATGGGACAGGGGCCTGG + Intronic
1035681590 8:1492669-1492691 CAGCCGGAGGCAGAGGGGCCGGG + Intergenic
1035814194 8:2521445-2521467 CAGACAATGTCAGATTAGCCTGG - Intergenic
1036390135 8:8318175-8318197 CAGCGACTGTAAGAGGGCCCCGG + Exonic
1036654827 8:10671395-10671417 CAGCCCCTGCCAGAGGAGCCTGG + Intronic
1037434373 8:18847150-18847172 CATCCCTTTTCAGAGGGGCCTGG - Intronic
1037710478 8:21351400-21351422 TCGGCAATGTCAGAGGGGCCAGG - Intergenic
1038312577 8:26455900-26455922 GGGCCAAAGACAGAGGGGCCAGG - Intronic
1041477003 8:58278044-58278066 CAGGCAAAGACAGAGGGGCATGG - Intergenic
1043418231 8:80073438-80073460 CAGCCAAGGTCACGGGGTCCAGG - Intronic
1047764506 8:127979627-127979649 AGGCCAATGCCAGAGGAGCCTGG + Intergenic
1048256443 8:132908508-132908530 CAGCCACTTTAAGAGGGGCTAGG + Intronic
1048336741 8:133508039-133508061 CAGACAATGACAGAGGGACATGG + Intronic
1049064064 8:140299123-140299145 GAGCCAATGATAGAGGGGCAGGG + Intronic
1053122116 9:35555312-35555334 GAGCCACTGGCAGAGGTGCCAGG + Exonic
1053484742 9:38443241-38443263 CAGCCAAGTTCAGTGGGGCTGGG + Intergenic
1059248741 9:112869280-112869302 AGGCCAATTCCAGAGGGGCCAGG - Exonic
1059482332 9:114601015-114601037 CAGCCATGGCCAGAGGGGCTGGG + Intergenic
1059983293 9:119796845-119796867 CAGACATTGTCATAGGTGCCAGG + Intergenic
1061005493 9:127926752-127926774 CAGCCAATGGCCGGGGGGCGGGG + Intronic
1061486378 9:130922556-130922578 CAGCAGATGTCAGAGAGGCGGGG - Intronic
1061721862 9:132556850-132556872 CAGCCAGCGCCAAAGGGGCCTGG - Intronic
1185824987 X:3241422-3241444 CAGCCAATGGAAGAGGTGCATGG + Intergenic
1187341700 X:18426181-18426203 CAGCCAAGGTCAGAAGGGCCCGG - Intronic
1189327414 X:40121203-40121225 GAGCCAAGGTCTGAGGGGCAGGG - Intronic
1193481693 X:82035474-82035496 CTGCCAAGGTCACAGGGACCAGG + Intergenic
1196441872 X:115726122-115726144 CTGCCAACGTGAGAAGGGCCCGG - Intergenic
1197163515 X:123350185-123350207 CTGCAAATGTCTGAGGGGCTAGG - Intronic
1200117307 X:153774999-153775021 CAGCCCAAGCCTGAGGGGCCAGG + Exonic