ID: 1096814263

View in Genome Browser
Species Human (GRCh38)
Location 12:54191758-54191780
Sequence AAGTGAGCAGAGTCGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096814263_1096814273 30 Left 1096814263 12:54191758-54191780 CCTAGCTCCGACTCTGCTCACTT 0: 1
1: 0
2: 2
3: 5
4: 148
Right 1096814273 12:54191811-54191833 CTTGCCTCGCCGCTTCTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1096814263_1096814272 29 Left 1096814263 12:54191758-54191780 CCTAGCTCCGACTCTGCTCACTT 0: 1
1: 0
2: 2
3: 5
4: 148
Right 1096814272 12:54191810-54191832 CCTTGCCTCGCCGCTTCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 118
1096814263_1096814268 -9 Left 1096814263 12:54191758-54191780 CCTAGCTCCGACTCTGCTCACTT 0: 1
1: 0
2: 2
3: 5
4: 148
Right 1096814268 12:54191772-54191794 TGCTCACTTGGGCTGCTAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096814263 Original CRISPR AAGTGAGCAGAGTCGGAGCT AGG (reversed) Intergenic
902344038 1:15802800-15802822 AAGTGAGCAGGGCAGCAGCTAGG + Intergenic
902624694 1:17669848-17669870 CAGTGTGCAGAGACAGAGCTGGG + Intronic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
903186442 1:21631969-21631991 GACAGAGCAGAGCCGGAGCTGGG - Intronic
903360824 1:22775976-22775998 AAGTTGGCAGAGTGGGAGGTGGG + Intronic
905543177 1:38776457-38776479 AAGGGAACAGAGTGGAAGCTAGG + Intergenic
907428165 1:54394497-54394519 CAGTAAGCATAGTAGGAGCTTGG + Intronic
907733534 1:57090042-57090064 AAGTGAGCAGAGGCAAAACTTGG + Intronic
910850918 1:91649183-91649205 AAGAGAGCAGGCTCAGAGCTTGG - Intergenic
911017079 1:93345462-93345484 AAGTGAGAAGAATGGGACCTGGG - Intergenic
911690753 1:100831431-100831453 AAGTACGTAGAGTCGGAGTTGGG - Intergenic
914391316 1:147225587-147225609 AAGCGAGCACAGACGGGGCTAGG - Exonic
915031090 1:152881033-152881055 AAGTGAAGAGAGTCTGCGCTGGG + Intronic
917843687 1:179002961-179002983 AAGTGAGCAGGGACAGAGCAAGG - Intergenic
917853299 1:179082799-179082821 CAGTGGGCCGAGTCGGGGCTGGG + Intronic
918305689 1:183243970-183243992 AAGTGAGCAGTGTTGGAGTGAGG + Exonic
923421360 1:233818640-233818662 GAGTGAGCAGAGTGGGAGTAAGG + Intergenic
923908935 1:238417779-238417801 AAATGATCAGAATAGGAGCTTGG - Intergenic
924431718 1:244002973-244002995 AAGTAAGCAGTGTGGGGGCTGGG - Intergenic
1063354504 10:5385495-5385517 AAGAGGGCAGACTCGGAGCAGGG - Intergenic
1063430096 10:5980567-5980589 AAGTGCACAGAGGCGGGGCTTGG - Intergenic
1065195182 10:23257469-23257491 ATGTGACTAGAGTGGGAGCTGGG - Intergenic
1065286345 10:24190901-24190923 AAATGATCAGAGGCGGGGCTCGG + Intronic
1066613163 10:37271249-37271271 AAGTGAGGAGACTCACAGCTTGG - Intronic
1069789191 10:71008801-71008823 AAGTGGCCAGAGGCAGAGCTAGG + Intergenic
1072771153 10:98139445-98139467 AAGTGAGAAGAAATGGAGCTAGG + Intronic
1075415443 10:122259106-122259128 AAGTGAGTGGAGAGGGAGCTAGG + Intergenic
1076438400 10:130462356-130462378 CAGGGAGCAGAGTCAGGGCTGGG - Intergenic
1076834428 10:133013976-133013998 AAGTGTTGAGAGACGGAGCTCGG + Intergenic
1077014041 11:392213-392235 AGGTGGGCAGAGTCGGCCCTGGG + Intergenic
1077369155 11:2173505-2173527 GAGTGAGCAGCGACGGAACTGGG - Intergenic
1078896069 11:15598326-15598348 CAGTGAGCAGGGTAGAAGCTGGG - Intergenic
1081371646 11:42311582-42311604 AACTGAGCAGTGAGGGAGCTGGG + Intergenic
1082084143 11:48035230-48035252 AGGCCAGCAGAGTCAGAGCTTGG + Intronic
1082085342 11:48045277-48045299 AAGCGAGCAGAGGCAGAGTTGGG + Intronic
1085271670 11:75273498-75273520 AAGAGAGCTGAGTCTGTGCTGGG + Intronic
1085503287 11:77041170-77041192 AAGTGAGTGGAGCTGGAGCTGGG + Exonic
1086435040 11:86771809-86771831 AAGGGAGCAGAGTGGTAGTTGGG + Intergenic
1088215695 11:107506024-107506046 AACTCAGCAGAGTAGCAGCTGGG + Intronic
1088770041 11:113025589-113025611 AAGTGAGCAGAGAAGGGGGTGGG + Intronic
1088961409 11:114669586-114669608 AAGTGAGAATAATTGGAGCTTGG - Intergenic
1089157624 11:116414390-116414412 AAGGGAGCTGAGTGGGAGGTAGG - Intergenic
1090275016 11:125413041-125413063 AAGAGATGAGAGCCGGAGCTCGG + Intronic
1092036360 12:5338595-5338617 AAGTGAGCAGAGCCTGGGCTTGG + Intergenic
1094398356 12:30033390-30033412 AAGTCAACTGAGTCTGAGCTAGG + Intergenic
1095551851 12:43451527-43451549 ATGGGAGCAGAGTTGGAGTTAGG - Intronic
1096747691 12:53739163-53739185 AAGTGAGCAGAGTGGGAGGTGGG + Intergenic
1096814263 12:54191758-54191780 AAGTGAGCAGAGTCGGAGCTAGG - Intergenic
1099037132 12:77602615-77602637 AAGAGAGCAGAGGGGGAGATGGG + Intergenic
1102800824 12:115732083-115732105 AAGTGAGTAGGGTCAAAGCTGGG + Intergenic
1104939997 12:132390560-132390582 ACGTGAGCTGAGCTGGAGCTGGG + Intergenic
1112257776 13:97850497-97850519 AAGTGCCCAGGGTAGGAGCTGGG + Intergenic
1116478961 14:45374485-45374507 AAGTGTACAGAGGCAGAGCTGGG - Intergenic
1117917277 14:60691039-60691061 AAATGAGCAGTTTCGGAGCCAGG + Intergenic
1118764560 14:68901121-68901143 AGGTGAGCAGAGTCTGAGGCAGG + Intronic
1120219187 14:81713460-81713482 AAGTGAGCAGAGAGGGAGAAAGG + Intergenic
1122635458 14:103127628-103127650 AAGTGAGCAGACCAGGGGCTGGG + Exonic
1124925967 15:34070937-34070959 CAGTGAGCAGAGTTAGACCTTGG - Intergenic
1129246603 15:74282806-74282828 AAATGAGCAGGGTCTAAGCTGGG - Intronic
1131642458 15:94307252-94307274 AAGAAAGCAGAGTAGGTGCTGGG + Intronic
1131843968 15:96469203-96469225 ATGACTGCAGAGTCGGAGCTGGG - Intergenic
1132367457 15:101267863-101267885 AAGTGAGCTGAGTGGAGGCTTGG + Intergenic
1133634942 16:7656406-7656428 AAGAGAGCAGAGTGGGACCCAGG + Intronic
1134904981 16:17972370-17972392 AAGTGAGCAGAGGCAGAGATGGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136631910 16:31493813-31493835 AAGTGGGCAGAGGCCCAGCTGGG + Intronic
1137960292 16:52875999-52876021 AAGTGAGCACGGTTGCAGCTCGG - Intergenic
1138093461 16:54194599-54194621 TGGGGAGCAGAGACGGAGCTGGG - Intergenic
1142964410 17:3571852-3571874 TAGTGAGCAGCGTCAGAGCCTGG - Intronic
1145053863 17:19685276-19685298 AAGTGAGCAGCGTCTCTGCTTGG + Intronic
1146685380 17:34837963-34837985 GCGTGAGCGGAGTCAGAGCTGGG + Intergenic
1147866312 17:43555077-43555099 AAGAGAGAGGAGTCGGAGCCTGG - Intronic
1149847654 17:60016893-60016915 AAGTGAGCACAAGAGGAGCTGGG - Intergenic
1152178255 17:78801938-78801960 AAGGGAGCAGACTCGGGGGTGGG + Intronic
1152351192 17:79784823-79784845 AGGTGAGGAGAGTAGCAGCTCGG + Exonic
1153810730 18:8749594-8749616 AAGAAAGCAGAGCCTGAGCTTGG + Intronic
1155400509 18:25433867-25433889 TGGTGAGCAGAGGCTGAGCTGGG - Intergenic
1156360605 18:36381385-36381407 AAGTGATCAGAGTGGAAGCATGG - Intronic
1159864697 18:73690326-73690348 TTGTGAGCAGTGTCTGAGCTGGG + Intergenic
1160419227 18:78732689-78732711 AAGTGAGCAGCTTCAGGGCTTGG - Intergenic
1160920675 19:1518815-1518837 CAGGGAGCAGGGTGGGAGCTGGG - Intergenic
1161068445 19:2249276-2249298 AAGTGAGCCGAGTGGAAGGTGGG - Intergenic
1161793879 19:6375639-6375661 CAGTGAGCAGGGTCAGGGCTGGG + Intronic
1162395884 19:10417876-10417898 GAGGGAGCAGAGTGGGAGGTGGG + Intronic
1163958520 19:20665620-20665642 AAGGGAACAGAGGCCGAGCTGGG - Intronic
1164636607 19:29796198-29796220 ATTTGAGCAGAGTCTGAGGTTGG - Intergenic
1165618278 19:37221651-37221673 AAGTGAGCATATTCCGGGCTGGG + Intronic
1165712180 19:38019674-38019696 AAGTGACCAGAATCAGAGCACGG + Intronic
925674227 2:6343247-6343269 AGGTGCACAGAGTCGGTGCTGGG + Intergenic
928429000 2:31202395-31202417 GAGTGAGCAGAGGTGGGGCTGGG + Intronic
935653074 2:105398849-105398871 AGGGGAGCAGAGCCGGAGTTGGG - Intronic
937702537 2:124880264-124880286 CAGTGATCAGTGTCAGAGCTAGG + Intronic
941661779 2:168202807-168202829 AAGTGAACTGAGACGAAGCTGGG + Intronic
945367260 2:208970226-208970248 AAGTGAGCCAAGACGGGGCTGGG + Intergenic
946325934 2:218984793-218984815 AAATGAGCAGATTGGGAGCCTGG - Intronic
946331601 2:219012448-219012470 AAGTGAACAGAGTTGGGGATAGG + Intronic
946477499 2:220022397-220022419 AAGTGGGCAGAGTGGGTGGTAGG + Intergenic
1169400512 20:5275370-5275392 AAGGGAGCAGAAGGGGAGCTGGG - Intergenic
1169766961 20:9156970-9156992 CAGAGAGCAGACACGGAGCTTGG + Intronic
1170307613 20:14957463-14957485 AAGTGATGAGAGGCAGAGCTGGG + Intronic
1172977830 20:38919872-38919894 ATGTGTGCAGAGTCAGTGCTCGG + Exonic
1174450542 20:50617423-50617445 GATTGTGCAGAGTGGGAGCTGGG - Intronic
1177376250 21:20274122-20274144 AAGTGGGCTGAGTCGGAGAAAGG - Intergenic
1178743631 21:35226611-35226633 AGGTGAGCAGAGTGGGCTCTGGG - Intronic
1179617724 21:42592877-42592899 AAGTGAGAAGAGTCAGAAATGGG + Intergenic
1183782808 22:40009519-40009541 AAAGGAGGAGAGTCCGAGCTGGG + Intronic
1184507071 22:44910288-44910310 AAGGGAACCGAGTCTGAGCTTGG + Intronic
950127568 3:10519420-10519442 AAGAGAGAAGAGTCACAGCTGGG + Intronic
951107964 3:18768094-18768116 AGGAGAGCAGAGTCTGTGCTTGG - Intergenic
952734220 3:36672937-36672959 AAGTTAGCAGAGTAGGAGGAGGG + Intergenic
953241302 3:41151710-41151732 AGGTAGGCAGAGTGGGAGCTTGG - Intergenic
959107070 3:102076779-102076801 AAGTGGGGAGAGTGGGAGGTGGG - Intergenic
961532371 3:127547485-127547507 AAGGGAGGAGGGACGGAGCTGGG + Intergenic
964409310 3:156381749-156381771 AGGTGAGCAGAGAAGGAACTAGG - Intronic
965609577 3:170530450-170530472 AAGTCACCAGAGCCAGAGCTTGG + Intronic
968473241 4:791462-791484 AAGTGGACAGAGGTGGAGCTGGG - Intronic
968554256 4:1239304-1239326 AGCTGGGCAGAGGCGGAGCTGGG + Intronic
968890763 4:3367309-3367331 AAGTGGGCAGAGTGCTAGCTCGG - Intronic
969915112 4:10483035-10483057 AATGGAGCAGAGTGGGAGATGGG - Intergenic
974325428 4:60408302-60408324 CAGTAAGCAGAGTAGAAGCTGGG - Intergenic
975201725 4:71597960-71597982 TAGGGAGCAGAGTGGAAGCTAGG - Intergenic
976401393 4:84611000-84611022 AAGAGAGCAAAGACGGAGCTGGG + Intronic
980075533 4:128289096-128289118 AGGTGAGGAGACTCAGAGCTAGG + Intergenic
984559761 4:181254605-181254627 AAATGAGCTGGGACGGAGCTCGG + Intergenic
985919876 5:2961985-2962007 AAGTGAGCAGAGCAGGAGACAGG + Intergenic
988986205 5:36621351-36621373 GAGGGAGCAGAGTAGGAGATGGG + Intronic
990773882 5:59283610-59283632 AAGTGAGCAGATTTGGGGCAAGG - Intronic
991400931 5:66250885-66250907 AAGTCAGCAGAGTCTGAGCTAGG - Intergenic
991613230 5:68469576-68469598 ATGTGAGCAGATTTGGAGATGGG + Intergenic
991648850 5:68830671-68830693 CAGGGAGCAGAAGCGGAGCTGGG - Intergenic
992018822 5:72602405-72602427 AAAGGAGCAGAGTGGAAGCTGGG - Intergenic
992698553 5:79315729-79315751 AAGTGACCAGATTGGGAACTGGG - Intronic
996081628 5:119264161-119264183 GAGTAAGCAGAGTAGGGGCTTGG + Intergenic
998167908 5:139855041-139855063 AAGTGAACAGAGAGGGAGCCGGG - Intronic
998543408 5:143004783-143004805 AAGTGAGCAGAGCCAGAGGGTGG + Intronic
999821607 5:155234352-155234374 AAGTGAGGGGAGTGGGAGATGGG + Intergenic
1000116400 5:158157965-158157987 AAGTGAACAGTGTAAGAGCTGGG + Intergenic
1001529610 5:172453274-172453296 AAGTGGGCAGTGGCGGAGCCTGG - Intronic
1007632497 6:43280371-43280393 AGGTGAGCAGAGCAGGAGGTGGG + Intronic
1007836372 6:44677043-44677065 TTGTGAGCAGAGGCTGAGCTGGG + Intergenic
1013030627 6:106329069-106329091 AAGAGAGCAGAATGGGACCTTGG - Intergenic
1015514940 6:134074147-134074169 AAGTGAGCCGAGTCCCAGATTGG - Intergenic
1023954323 7:44872166-44872188 AAGTGAGCAGAGTCTCTGCCTGG - Intergenic
1031165197 7:118219409-118219431 AAGTCATCAGAGTAGGAGATAGG + Intronic
1031524145 7:122804073-122804095 AAGAGAGCAGTGTGGTAGCTGGG - Intronic
1031810808 7:126366470-126366492 AAATGAGCAGAGAGAGAGCTGGG + Intergenic
1039024050 8:33238459-33238481 AAGTGAGAAGATAAGGAGCTTGG + Intergenic
1039252617 8:35683461-35683483 AAGTGAGCAGATTCGGGTGTGGG - Intronic
1042398473 8:68318008-68318030 CCGTGTGCAGAGTGGGAGCTGGG - Intronic
1050544836 9:6700946-6700968 GAGTGAGGAGAGTCGGATCTGGG + Intergenic
1059453857 9:114387617-114387639 AAGAGATCAGAATCAGAGCTAGG + Intronic
1062504271 9:136865478-136865500 TAGTGACCTGAGTGGGAGCTGGG - Intronic
1185681861 X:1895105-1895127 AAGTGACCAGAGGCTGGGCTGGG + Intergenic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1193462106 X:81803612-81803634 CAGTGAGCAGAGTCGAGCCTGGG - Intergenic
1198177023 X:134166672-134166694 AGGTGAACAAAGGCGGAGCTGGG + Intergenic