ID: 1096814287

View in Genome Browser
Species Human (GRCh38)
Location 12:54191861-54191883
Sequence CACTGCACAAAACAAAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096814270_1096814287 29 Left 1096814270 12:54191809-54191831 CCCTTGCCTCGCCGCTTCTCACG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG 0: 1
1: 0
2: 0
3: 18
4: 211
1096814275_1096814287 23 Left 1096814275 12:54191815-54191837 CCTCGCCGCTTCTCACGGGGAAG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG 0: 1
1: 0
2: 0
3: 18
4: 211
1096814278_1096814287 18 Left 1096814278 12:54191820-54191842 CCGCTTCTCACGGGGAAGGGCTG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG 0: 1
1: 0
2: 0
3: 18
4: 211
1096814271_1096814287 28 Left 1096814271 12:54191810-54191832 CCTTGCCTCGCCGCTTCTCACGG 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG 0: 1
1: 0
2: 0
3: 18
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096814287 Original CRISPR CACTGCACAAAACAAAGGTC GGG Intergenic
903318471 1:22527047-22527069 CTCTTCCCAAAACAAAGCTCTGG + Exonic
905287315 1:36889892-36889914 AACTGCTCAATAAAAAGGTCAGG - Intronic
905482386 1:38270560-38270582 CAATGGGCAAAACAAAGGGCAGG + Intergenic
906815074 1:48870405-48870427 CAGTTCCCAGAACAAAGGTCTGG + Intronic
907650670 1:56291821-56291843 GACTGCATTACACAAAGGTCTGG - Intergenic
907676637 1:56523793-56523815 CACTGCTCAAATCAAAGGGTGGG + Intronic
908671421 1:66552368-66552390 CAGTGCAGAAAAGAAAGGTGAGG - Intronic
909107906 1:71435729-71435751 GACTGCACAAAAAGAAGGCCTGG + Intronic
909226778 1:73034588-73034610 CTCTTCACAAACCAAAGATCAGG + Intergenic
909653726 1:78006140-78006162 CAATGCAAAAAACAAAAGTATGG - Intronic
910853276 1:91669654-91669676 CACACCACAAAACAAAGAACAGG + Intergenic
911054881 1:93701010-93701032 CACTGCTCAAAACCCAGGTTTGG - Intronic
914398745 1:147296001-147296023 CACTGCACAACATCAAGATCTGG + Intergenic
916352082 1:163861927-163861949 CAGAGCACTAAACAAAGCTCTGG + Intergenic
916766356 1:167864192-167864214 CACACCACAAAACAAAGAACGGG - Intronic
918647772 1:186922164-186922186 CACATCACAAAACAAAGAACGGG + Intronic
920525812 1:206665068-206665090 CAGTGCATAAAAGAAATGTCCGG - Intronic
921074425 1:211688118-211688140 CACACCACAAAACAAAGAACAGG - Intergenic
921494692 1:215824794-215824816 CAGTGCAGAAATCAAGGGTCAGG + Intronic
922181015 1:223232924-223232946 AACTGCATAACACAAAGGTCAGG + Intronic
922680979 1:227595637-227595659 CACACCACAAAACAAAGAACGGG + Intronic
922689942 1:227680261-227680283 CACACCACAAAACAAAGAACAGG - Intergenic
924859292 1:247904824-247904846 CACACCACAAAACAAAGAACGGG + Intergenic
1064947787 10:20811320-20811342 CCCTGCACACATCAGAGGTCAGG - Intronic
1065930828 10:30477150-30477172 CACACCACAAAACAAAGAACAGG - Intergenic
1066633197 10:37476953-37476975 CCCTGAAAAAAACAAAAGTCTGG + Intergenic
1067050059 10:43010629-43010651 CACTGCACCAAGCAAAGCTGTGG + Intergenic
1069391085 10:67935829-67935851 CACTTCACAAAACAAAAGTTTGG - Intronic
1069458706 10:68574429-68574451 CACTGCACAAGACATACTTCAGG - Intronic
1070665054 10:78336828-78336850 CACTGCACAAACCCAAGGGGAGG + Intergenic
1075286615 10:121192623-121192645 CAGTGAACAAACCAAAGCTCTGG + Intergenic
1078734640 11:14008750-14008772 GACTCTACAAAACAAAGGTGGGG - Intronic
1081439858 11:43068052-43068074 CTCTGCCCTCAACAAAGGTCTGG + Intergenic
1083082386 11:60107796-60107818 CACACCACAAAACAAAGAACGGG + Intergenic
1083197073 11:61094661-61094683 CACACCACAAAACAAAGAACGGG - Intergenic
1083488959 11:63000822-63000844 CACTGCACAAGAGAAAGGTAGGG + Exonic
1083976358 11:66124793-66124815 CATTTCAGAAAACAAAAGTCTGG + Intronic
1091299491 11:134498389-134498411 CTCTGCACACAACAAGGCTCTGG - Intergenic
1091814789 12:3429465-3429487 CACACCACAAAACAAAGAACAGG + Intronic
1096207499 12:49735183-49735205 CACACCACAAAACAAAGAACAGG - Intronic
1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG + Intergenic
1097730813 12:63126142-63126164 CACTACACAAAACGAAGTTGCGG + Intergenic
1100431535 12:94535491-94535513 CACTCCAGACGACAAAGGTCTGG + Intergenic
1100791104 12:98131083-98131105 CACTGCAAAAAAACAAGGCCTGG + Intergenic
1101029831 12:100647676-100647698 CACACCACAAAACAAAGAACGGG + Intergenic
1104418266 12:128613691-128613713 TACTGCACCAAACAAAGCACTGG - Intronic
1104579229 12:129997630-129997652 AGCTGAACAAAACACAGGTCTGG - Intergenic
1107198175 13:37680427-37680449 CACTTCAAAAAACAGAGGTTTGG + Intronic
1108717249 13:53092996-53093018 GACTCCACCAATCAAAGGTCAGG + Intergenic
1109802427 13:67398121-67398143 CACACCACAAAACAAAGAACAGG - Intergenic
1110653926 13:77974980-77975002 CACACCACAAAACAAAGAACCGG + Intergenic
1111674167 13:91366675-91366697 CACAGCACAAATCGAAGGTTAGG + Intergenic
1115334268 14:32229484-32229506 CACTGCCCAAATCAAAGACCTGG - Intergenic
1115911259 14:38258981-38259003 CACTGCACAAAACAAAAGCTAGG - Intergenic
1116750963 14:48882972-48882994 CTCTGCACATAACAAGGGTGAGG - Intergenic
1117064468 14:51996920-51996942 CACTCTACAAAATAAATGTCAGG - Intronic
1118679950 14:68230527-68230549 CACTGCCCATAATAAAGGTCAGG + Intronic
1120455651 14:84726861-84726883 CATTGCACACAAAAAAGCTCAGG - Intergenic
1125988633 15:44082153-44082175 AACTCTACAAAACAAAGGTAAGG + Intronic
1126740052 15:51768402-51768424 CACTGGAGAAAAGAAAGGTAAGG + Exonic
1127405720 15:58643520-58643542 CACTGCACAAAGCAAATTTTAGG + Intronic
1130630019 15:85558173-85558195 CACTGCACAATAAACAGGTAAGG - Intronic
1135713673 16:24741763-24741785 CACTGCACTAAGCTAAGGTTAGG - Intronic
1136963848 16:34883466-34883488 AAATACACAAAACACAGGTCAGG + Intergenic
1137714791 16:50592111-50592133 CCCTGCTCAAAACACAGGCCTGG - Intronic
1142033683 16:87851066-87851088 CACAGCACAAGACCAAAGTCTGG + Intronic
1142038753 16:87879042-87879064 CACTGCCCAAAACAGAGGCGGGG - Intergenic
1142068167 16:88074540-88074562 CTCTGCCCAGAACACAGGTCTGG + Intronic
1144543996 17:16175324-16175346 CACTGCACAACACAACAGTCTGG + Intronic
1144741061 17:17582524-17582546 CACCACACACAACAAAGGGCAGG + Intronic
1145058581 17:19718497-19718519 AGCTGCACAGGACAAAGGTCGGG + Intronic
1146366580 17:32233617-32233639 CACTGGACAAAGCACAGGTGAGG - Intronic
1147810504 17:43166642-43166664 CACACCACAAAACAAAGAACCGG + Intergenic
1148817187 17:50337414-50337436 CACTGCACAAGACACAGACCTGG + Intergenic
1148829221 17:50419490-50419512 CACACCACAAAACAAAGAACAGG + Intergenic
1149759203 17:59214287-59214309 CCCTGCAAAAAAAAAAGTTCTGG + Intronic
1153830137 18:8914596-8914618 CACACCACAAAACAAAGAACGGG - Intergenic
1154014306 18:10603224-10603246 CACACCACAAAACAAAGAACAGG + Intergenic
1154399172 18:14018775-14018797 CACTTCACGGAAGAAAGGTCAGG - Intergenic
1155045804 18:22102024-22102046 GACTGCAAAAAACCAAGGCCTGG + Intergenic
1155314985 18:24562665-24562687 CTCTGCACAAGAAAGAGGTCGGG + Intergenic
1156429476 18:37056540-37056562 CACAGCATAAAACAAAGATGAGG - Intronic
1158427900 18:57354680-57354702 GACTGCACAAAGCAATGATCAGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160904384 19:1445597-1445619 CACTGAACAAAACAAAATCCAGG - Intergenic
1161830338 19:6598116-6598138 CACACCACAAAACAAAGAACGGG - Intronic
1162281711 19:9703296-9703318 CACACCACAAAACAAAGAACGGG - Intergenic
1163991557 19:21003332-21003354 CACACCACAAAACAAAGAACGGG - Intergenic
1164511935 19:28904578-28904600 CACTGTACAAAACAGAGGGGCGG + Intergenic
1164846311 19:31436055-31436077 CACTGACCAAAACTGAGGTCTGG + Intergenic
1166160093 19:40946228-40946250 TACTGCACAAAACCAGGGGCTGG - Intergenic
1168613077 19:57816212-57816234 CACACCACAAAACAAAGAACAGG - Intronic
925122066 2:1427222-1427244 CACTGCACATCATAAAGATCTGG - Intronic
926462616 2:13151117-13151139 AACTGCACAAAACCAAAATCAGG - Intergenic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
931835399 2:66093774-66093796 CACTCCACAGCACAAAGGTTAGG - Intergenic
931998110 2:67858243-67858265 CTCTTCACAAAACCAAGGTGAGG - Intergenic
935389187 2:102532531-102532553 CACTGCATGAAACAGAGGTTTGG - Exonic
935721692 2:105985379-105985401 CACACCACAAAACAAAGAACAGG + Intergenic
935819217 2:106877412-106877434 CATTGCACACAACGAAGGTGTGG - Intronic
937041644 2:118825715-118825737 CACTGCACAAAGCTAAGCTTAGG + Intergenic
938563558 2:132496248-132496270 CATTTCAGAAAACAAAGGTAAGG + Intronic
938679646 2:133676623-133676645 CATTGCACAAGACAAAAGTAGGG - Intergenic
940424101 2:153511277-153511299 CACTGCAAAAAAAAAAGGGGCGG + Intergenic
941459310 2:165749234-165749256 TACTGCACAAAACAATGTTCAGG + Intronic
943355584 2:186851214-186851236 TACTGCAAAAAACAAAGCTGTGG + Intergenic
943550141 2:189328477-189328499 GCCTCCAGAAAACAAAGGTCAGG + Intergenic
944011442 2:194979445-194979467 CAGTGCAGAAAAGAAAGGTGGGG - Intergenic
944482306 2:200170489-200170511 TACAGCACAAGACAAAGGACGGG - Intergenic
944673670 2:202016979-202017001 CACTGGCCAAAACACAGTTCTGG - Intergenic
946189060 2:217997936-217997958 CACTACAGAAAACAGAGGCCAGG - Intronic
946443242 2:219714797-219714819 CAATGACCAAAACAAAGGACAGG - Intergenic
946497511 2:220209931-220209953 CACTGACAAAAAGAAAGGTCTGG + Intergenic
947971831 2:234331382-234331404 CACTGCCCAAACCCGAGGTCAGG - Intergenic
1174085798 20:48006374-48006396 CACTGCACAAACCAGAGCCCAGG - Intergenic
1174515932 20:51092495-51092517 CACTGAACAAAGAAAAAGTCTGG - Intergenic
1176244987 20:64093201-64093223 CACAGCTCAAACCAGAGGTCAGG - Intronic
1176953195 21:15069439-15069461 GACTGCCTCAAACAAAGGTCAGG - Intergenic
1178525360 21:33324402-33324424 CTCTGCACACAGCAACGGTCTGG + Intergenic
1179592041 21:42415288-42415310 GACTGCTAAAAACAAAAGTCAGG + Intronic
1179669108 21:42933034-42933056 CACACCACAAAACAAAGAACAGG - Intergenic
1180136859 21:45867572-45867594 CTGTGCACAACACAAGGGTCGGG - Intronic
1182156357 22:28076794-28076816 CACTACCCAAAACAAAAGCCAGG + Intronic
1182852715 22:33489773-33489795 CAATGAACAAAACAAAGCCCTGG + Intronic
1183726088 22:39590413-39590435 CACTGCATACAACACAGGCCTGG + Intronic
1184634607 22:45817100-45817122 CACTGCATCAAACAAACGTCAGG - Intronic
951166557 3:19489724-19489746 CACACCACAAAACAAAGAACAGG + Intronic
951248757 3:20370352-20370374 CACACCACAAAACAAAGAACGGG + Intergenic
951270811 3:20621182-20621204 CACTGTCCAAAACAAAAGCCTGG - Intergenic
954534500 3:51349009-51349031 CACAGCACTAAACTAAGGGCTGG - Intronic
955588624 3:60510116-60510138 GAATTCATAAAACAAAGGTCAGG + Intronic
956221083 3:66904051-66904073 AACTACACAGAACAAAGCTCTGG + Intergenic
956915579 3:73867582-73867604 CACTGCACCTCACAAAGGGCTGG + Intergenic
956995931 3:74825990-74826012 CACACCACAAAACAAAGAACAGG - Intergenic
958000190 3:87740378-87740400 CACACCACAAAACAAAGAACGGG + Intergenic
959820750 3:110732539-110732561 CAATGCAAAAAGGAAAGGTCTGG + Intergenic
960547221 3:118929537-118929559 CACTGCAGAAAATAATGCTCAGG - Intronic
960823736 3:121760841-121760863 ACCTGCAGAAACCAAAGGTCTGG - Intergenic
961764905 3:129202146-129202168 AACTGCTCAAAACAATGTTCTGG - Intergenic
962096248 3:132295922-132295944 CACACCACAAAACAAAGAACAGG - Intergenic
962096951 3:132302466-132302488 CACACCACAAAACAAAGAACAGG + Intergenic
962302590 3:134255921-134255943 CACTGCCCAATAGAAATGTCAGG - Intergenic
962733187 3:138301577-138301599 TACTGCACAAAACAGACCTCCGG - Intronic
962777121 3:138672161-138672183 CACTACACAAAACTGAGGTCTGG + Intronic
964010109 3:151882778-151882800 TCCTGCACAAAACAAATGTAGGG + Exonic
964522981 3:157587039-157587061 CACACCACAAAACAAAGAACGGG + Intronic
971027240 4:22600327-22600349 CACACCACAAAACAAAGAACAGG - Intergenic
972502932 4:39695133-39695155 CACTGCACCGGACAAGGGTCTGG - Intergenic
972991579 4:44827677-44827699 CACTCCACAAAACAAAGAATGGG + Intergenic
973730982 4:53822124-53822146 CAGTTCAGAAAATAAAGGTCTGG + Intronic
974161397 4:58145350-58145372 GAGTGCAAAAAATAAAGGTCAGG - Intergenic
974949909 4:68575589-68575611 CACACCACAAAACAAAGAACGGG + Intronic
974987895 4:69051939-69051961 CACACCACAAAACAAAGAACAGG - Intronic
975205404 4:71639253-71639275 CACACCACAAAACAAAGAACAGG - Intergenic
975370009 4:73574212-73574234 GACTGCACAAGACAAAGCTCAGG - Exonic
975914171 4:79303455-79303477 CACTGTAATTAACAAAGGTCAGG - Intronic
975996690 4:80323293-80323315 AACTGCACAAAACAAAGACCAGG - Intronic
977043833 4:92045247-92045269 CACACCACAAAACAAAGAACGGG + Intergenic
978490969 4:109311663-109311685 GAATGCACTAAAGAAAGGTCTGG + Intergenic
979270676 4:118756991-118757013 CACAGCCCAAAACAAATTTCAGG - Intronic
980826596 4:138080978-138081000 CGCTGCAGACCACAAAGGTCAGG - Intergenic
982444264 4:155471756-155471778 CACAGCACAAAGCAAGGTTCTGG + Intergenic
984420928 4:179520307-179520329 CAGTTCACAAAGCAAAGGTTTGG + Intergenic
985246226 4:187982395-187982417 CAATGTTCAAACCAAAGGTCAGG - Intergenic
986183894 5:5418667-5418689 CACTGATTAAAACAAAGCTCTGG + Intergenic
986793929 5:11191135-11191157 CAGTGCACACAGCAGAGGTCTGG + Intronic
987400098 5:17466335-17466357 CACAGCACATGACAAAGGACTGG - Intergenic
989096326 5:37785191-37785213 CACACCACAAAACAAAGAACGGG + Intergenic
990147782 5:52782079-52782101 CACCCCACAAAACAAAGACCTGG + Intergenic
992522091 5:77564743-77564765 TGCAGCACAAAGCAAAGGTCAGG - Intronic
993476211 5:88368041-88368063 CACCACACAAGACAAAAGTCAGG - Intergenic
994112479 5:96022478-96022500 CACTGGACAAAACAATGTTCTGG + Intergenic
998056082 5:139078663-139078685 CACTGCACACATCAAATGCCAGG + Intronic
999511582 5:152257940-152257962 CACTGCACAGAGGAAAGATCAGG - Intergenic
1000236585 5:159367129-159367151 CACACCACAAAACAAAGAACGGG - Intergenic
1002090391 5:176802268-176802290 CACTGCACACAACATGGGCCAGG - Intergenic
1003250843 6:4428138-4428160 CACACCACAAAACAAAGAACGGG + Intergenic
1003616634 6:7660523-7660545 CCCTGCACCAAACAGAGGCCAGG - Intergenic
1004754138 6:18593386-18593408 CACTGCTTAAAACAAAGAACAGG - Intergenic
1005426352 6:25706705-25706727 CACTGCTCAAAACCAGGGGCTGG + Intergenic
1008096747 6:47346824-47346846 AACTACAGAAAACAAAGGTGTGG - Intergenic
1008467568 6:51847686-51847708 CACTTCACAGCACAAATGTCTGG + Intronic
1011135301 6:84093569-84093591 CACTGCACAAGGAAAAGGGCAGG + Intergenic
1015950782 6:138550473-138550495 CTCTGGACAGCACAAAGGTCTGG + Intronic
1018459612 6:163985374-163985396 CTCTGGACAATACAAAGGACTGG + Intergenic
1020918759 7:14233912-14233934 CACTTAACTAAACAAAGGCCTGG + Intronic
1023181042 7:37484167-37484189 CACTCTAGAAAACAAAGGTTGGG - Intergenic
1024494986 7:50035300-50035322 CACTGCTGAAAACAAAAGCCAGG - Intronic
1028274684 7:88840131-88840153 CACTGACCAGAACAAAGTTCTGG + Intronic
1028383351 7:90224214-90224236 CACTGGACCAAACTGAGGTCAGG + Intronic
1028781504 7:94742706-94742728 TTCTGCACAAATCAAAGCTCAGG + Intergenic
1029485904 7:100840173-100840195 CACACCACAAAACAAAGAACAGG - Intronic
1030978223 7:116153766-116153788 CACTGCATAAAAAAAAGATTAGG + Intronic
1036010223 8:4713651-4713673 CTCTTAACAAAACAGAGGTCAGG + Intronic
1037534663 8:19813315-19813337 CACAGCATAAAAGACAGGTCAGG + Intergenic
1038084215 8:24175390-24175412 CACTTCAGGAAAGAAAGGTCTGG + Intergenic
1038089401 8:24236440-24236462 CACAGCACAAAACAAAGAGAGGG - Intergenic
1039877101 8:41596262-41596284 CACACCACAAAACAAAGAACGGG + Intronic
1040993604 8:53378689-53378711 CACACCACAAAACAAAGAACAGG + Intergenic
1041612360 8:59866384-59866406 CCTTGAACAAAACAAAGGTCAGG + Intergenic
1042201872 8:66286476-66286498 CACTGTACAAAACAAAGATAAGG + Intergenic
1046784479 8:118251495-118251517 CAGTGCACACAGCAAAGGTGGGG - Intronic
1046813303 8:118556083-118556105 CAGAGCACTGAACAAAGGTCTGG + Intronic
1047756509 8:127922988-127923010 CACTGCCCAAAATATGGGTCAGG - Intergenic
1048263093 8:132962048-132962070 CAATGCACAAAACAATGCTGTGG + Intronic
1052181589 9:25535074-25535096 AACTGCAGAAAATAAAGGCCAGG + Intergenic
1052375164 9:27711032-27711054 CATTGCCCAAAACAAGGGTCTGG - Intergenic
1053043684 9:34895692-34895714 CATCCCACAAAACAAAGGTAGGG + Intergenic
1056210909 9:84364389-84364411 GTCTTTACAAAACAAAGGTCAGG - Intergenic
1057367181 9:94433365-94433387 CATTGCGTAAAAAAAAGGTCAGG + Intronic
1059871876 9:118586968-118586990 CAGTGCAGAAAACAAATGTGGGG + Intergenic
1185583808 X:1230420-1230442 AAATGCATAAAACAAAGGCCGGG + Intergenic
1186558810 X:10589062-10589084 CACACCACAAAACAAAGAACAGG + Intronic
1186630344 X:11341594-11341616 AACTGCACAAAGCAGAGGTCAGG - Intronic
1187534304 X:20124099-20124121 AACTGAACAAAACAATGGACTGG + Intergenic
1187713595 X:22078748-22078770 AACTGCAGACAACAAAGGTATGG + Intronic
1188422989 X:30011743-30011765 CAGTGAATAAAACAAAGTTCCGG - Intergenic
1189722866 X:43938475-43938497 CACTGAACAAGAAAAAGGTTTGG - Intergenic
1190269946 X:48854661-48854683 CACACCACAAAACAAAGAACGGG - Intergenic
1191639033 X:63410228-63410250 CACACCACAAAACAAAGAACGGG - Intergenic
1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG + Intergenic
1196423257 X:115544360-115544382 CACACCACAAAACAAAGAACGGG + Intergenic
1196579417 X:117361647-117361669 CACTGCAGAAAAGAAATGTGGGG + Intergenic
1197284406 X:124579158-124579180 CTCTGCACAAAGCACAGCTCTGG + Intronic
1197803431 X:130376021-130376043 CACTTCACAAAACAAAATTCTGG + Intergenic
1198789338 X:140326593-140326615 CACTGAACAAAACAAAGCCCCGG + Intergenic
1199539673 X:148945113-148945135 CACTGCCCAAGCCAAGGGTCAGG - Intronic
1200394651 X:155976696-155976718 CACACCACAAAACAAAGAACAGG + Intergenic
1201308039 Y:12567968-12567990 CACACCACAAAACAAAGAACAGG - Intergenic
1201372800 Y:13283368-13283390 CACACCACAAAACAAAGAACAGG - Intronic