ID: 1096814590

View in Genome Browser
Species Human (GRCh38)
Location 12:54193915-54193937
Sequence GAGTGGCCATGGGACCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096814583_1096814590 30 Left 1096814583 12:54193862-54193884 CCACAGGTTGAACCAAATTGAGC 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1096814590 12:54193915-54193937 GAGTGGCCATGGGACCAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1096814584_1096814590 18 Left 1096814584 12:54193874-54193896 CCAAATTGAGCAACTAGAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1096814590 12:54193915-54193937 GAGTGGCCATGGGACCAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096814590 Original CRISPR GAGTGGCCATGGGACCAAGT GGG Intergenic
901866300 1:12109292-12109314 GAGTGGCCATGAGACCAGGCTGG - Intronic
903944171 1:26951363-26951385 CAGTGGCCATGAGACCATGGTGG - Exonic
905456951 1:38094866-38094888 GAGTGGGCATGGGGCAAAGGAGG + Intergenic
906945292 1:50289744-50289766 GAGTGACCTTGGGGCCAGGTGGG + Intergenic
907329704 1:53663063-53663085 GAGTGGCCATGGAGCTCAGTGGG - Intronic
907343124 1:53751688-53751710 ATGTGGCCATGGGACCACTTTGG + Intergenic
909560982 1:77009026-77009048 TAGTGGCCAAGAGCCCAAGTAGG - Intronic
910540875 1:88355386-88355408 GAGTGGACAGGGGAAGAAGTTGG - Intergenic
911057605 1:93721766-93721788 GAGAGGCCATGTGACAAAGTAGG + Intronic
911123933 1:94322875-94322897 GTGTGGCCATGAGACCATTTGGG + Intergenic
912030725 1:105240060-105240082 GAGTGGCCATGGCTGCAAGGAGG - Intergenic
912602526 1:110951566-110951588 GATTGGCCATGGAAGCAAGCTGG + Exonic
915786444 1:158618198-158618220 GAGAGGCCTTGGGAACCAGTGGG - Intronic
916651417 1:166838340-166838362 GAGTGGTCAGGGGACCAGGGTGG - Intergenic
917212947 1:172648388-172648410 AAGTTGCCATGGGATCCAGTTGG + Intergenic
917976665 1:180244328-180244350 GAGAGGCCTTGGGACCAAACCGG - Intronic
919868707 1:201803892-201803914 GGGTGGCCTTGGGGACAAGTAGG - Intronic
920154057 1:203934005-203934027 GGGAGGCTGTGGGACCAAGTAGG - Intergenic
923497336 1:234537052-234537074 GGGTGCCCATGGGGCCAAGGAGG + Intergenic
924028310 1:239861589-239861611 AATTGTCCATGGGACCAAGTTGG + Intronic
1068622777 10:59205320-59205342 GGTTGGCCATGGGACCAAAAGGG + Intronic
1069340554 10:67403572-67403594 GAGTGCCCAGGGGGCCAGGTGGG + Intronic
1069710888 10:70487887-70487909 GAGTGGGCCTGGGCCCAAGGTGG - Intronic
1073176385 10:101560016-101560038 GGGTGGGCCTGGGACCAAGAGGG - Intergenic
1073551592 10:104407369-104407391 AAGAGGAAATGGGACCAAGTAGG - Intronic
1074104187 10:110376424-110376446 CAGCGGTCATGGGACAAAGTTGG - Intergenic
1076701428 10:132275233-132275255 GAGTAGCCATGGGGCCTGGTGGG - Intronic
1082772672 11:57220503-57220525 GATAGGCCATGGGACCAGGAAGG + Intergenic
1083310627 11:61781800-61781822 GACTGGCCCTGGGCCCAGGTGGG - Exonic
1088532626 11:110827367-110827389 GAGTGGTGATGTGACCATGTAGG + Intergenic
1090569031 11:128027366-128027388 CAGTGGACATGGGCCCAAGCAGG - Intergenic
1096553744 12:52390764-52390786 GAGGGGCCAGGGGAACAAGGAGG + Intergenic
1096814590 12:54193915-54193937 GAGTGGCCATGGGACCAAGTGGG + Intergenic
1102657676 12:114496542-114496564 GAGTGGCCACTGGTCCAAGAAGG - Intergenic
1103902203 12:124309136-124309158 GTGTGGCCCTGGGGCCCAGTGGG + Intronic
1105320824 13:19319947-19319969 GAGTTGCCATGTACCCAAGTAGG + Intergenic
1105656969 13:22452206-22452228 GAGTGGCCCTGGGAGCAATCTGG + Intergenic
1107791096 13:44003180-44003202 GAGGGGCCATGGGAACTGGTCGG - Intergenic
1110726231 13:78827673-78827695 TGGTGGGCATGTGACCAAGTTGG + Intergenic
1117166178 14:53036216-53036238 GAGTTACTATGGGACCAAGTTGG + Intergenic
1118323798 14:64768482-64768504 GAGTGGCCAGGGGCACCAGTTGG + Intronic
1121696242 14:95914577-95914599 GAGTGGCTATGTGGACAAGTAGG + Intergenic
1121731390 14:96189607-96189629 AAGTGGCCAGGGGACCGAGCTGG + Intergenic
1122367518 14:101202919-101202941 CAGTGGCCATGGGGTCAACTGGG - Intergenic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1127198360 15:56614982-56615004 GATTGGCCTTGGGGCCAAGCAGG + Intergenic
1134238299 16:12485171-12485193 GAGTGGGCATGAGGCCAAGCAGG + Intronic
1135860836 16:26054520-26054542 CAGTGGCCAGCAGACCAAGTTGG + Intronic
1141985095 16:87574882-87574904 GAGTGGCAAAGGGACCAGGGAGG - Intergenic
1146674277 17:34762277-34762299 AGGTGGCCATGTGACCATGTTGG + Intergenic
1148219280 17:45850490-45850512 GATTGGCCAGGGGAGCAAGGTGG - Intergenic
1149665637 17:58363212-58363234 GAGTTGCCACAGGACAAAGTAGG + Intronic
1149802988 17:59587896-59587918 GAGTGGCCATGTCACCAGATTGG + Exonic
1149843498 17:59987582-59987604 GAGTGGCCATGTCACCAGATTGG - Intergenic
1152343448 17:79737776-79737798 CAAAGGCCATGGGACCAAGGGGG + Intronic
1152815373 17:82404611-82404633 GGGTGGGCATGGGCCCATGTGGG + Intronic
1155157181 18:23167711-23167733 GGGAGGCCATGGGAGCAAGGAGG + Intronic
1157769551 18:50333756-50333778 GGGTGGCTATGGGACCATGGGGG + Intergenic
1159324125 18:66893351-66893373 GGGTGACCATAGGGCCAAGTGGG - Intergenic
1159689121 18:71463400-71463422 GGGTGTGCATGGGACCTAGTTGG + Intergenic
1160385704 18:78495031-78495053 GCGTGGCCATGGGGACAAGATGG - Intergenic
1160442476 18:78903013-78903035 GAGTGGCCTTGGGAAGCAGTCGG - Intergenic
1161962286 19:7529459-7529481 GTGTGGTCATGGGAGCCAGTGGG - Intronic
1162544734 19:11321916-11321938 TGGTGGCCATGGGACCCAGTGGG + Intronic
1164810060 19:31148452-31148474 GAGGGGCCATCTGACCAAGGGGG - Intergenic
925686507 2:6479137-6479159 GGGTGCCCATGGGACCTGGTTGG - Intergenic
926197472 2:10772623-10772645 CAGGGGCCCTGGGACCAAGCTGG - Intronic
930501228 2:52220790-52220812 GATTGGCCATGGGCCAAGGTGGG - Intergenic
930717018 2:54602920-54602942 GACTGGCCATGGAACCTCGTTGG + Intronic
931034014 2:58216254-58216276 GATTGGCAAAGGGCCCAAGTGGG - Intronic
932164486 2:69493735-69493757 GAGTGCCCATGGGACCACACTGG + Intronic
932622127 2:73270928-73270950 TATCGGCCATGGGACCAAGTAGG - Intronic
933776251 2:85772996-85773018 GAGGGGACATGGGAGCAAGAAGG + Intronic
942939195 2:181597496-181597518 GAGTGCCCATGGGAAGAAGCTGG + Intronic
947738719 2:232474814-232474836 GAATGGCCAGGGGAACATGTGGG + Intergenic
947934512 2:233992512-233992534 GAGTGGAAATGGTACCAAGAGGG - Intronic
1170011314 20:11727255-11727277 GAATGGCCATGGCACCATGTGGG + Intergenic
1171305658 20:24103901-24103923 GCATGGCCATGGGGCCAACTTGG - Intergenic
1174292324 20:49517906-49517928 GTGTGGGCATGGGACCCAGGCGG + Intronic
1175360189 20:58403877-58403899 GAATGGCCCTTGCACCAAGTTGG + Intronic
1175870227 20:62205864-62205886 GAGGGGCCCGGGCACCAAGTAGG - Intergenic
1177450372 21:21258397-21258419 GAGTGCCCATGGGAACTAGGTGG + Intronic
1177600935 21:23312945-23312967 GAGTGGCTTTGGGACCAGGCAGG - Intergenic
1178421460 21:32446813-32446835 GAGTGGCCATGGAAGGAGGTAGG - Intronic
1179799595 21:43804730-43804752 GAGTGGGCCTGGGACCAGGAAGG + Exonic
1180248136 21:46562147-46562169 GAGTGGCCCTGGCCCTAAGTTGG + Intronic
1185048042 22:48538785-48538807 GACTGGCCATGGGACTTACTTGG - Intronic
952967923 3:38632486-38632508 GGCTGGCAATGGGACCAAGAAGG - Intronic
961457199 3:127030148-127030170 AAGTGGCCATGGGAGCATGGGGG - Intronic
966402884 3:179564507-179564529 GAGTGGCCATGGGAGGCAGGAGG - Intronic
966917111 3:184591077-184591099 GAATGGCCCTGGGAGGAAGTGGG + Intronic
978329920 4:107601339-107601361 GAGAGGCCATGGGACAAGTTTGG - Intronic
979994493 4:127414402-127414424 GTGTGGCCGTGGGCCCAATTGGG - Intergenic
980960506 4:139470315-139470337 GAGTGGCAATGGCTACAAGTGGG - Intronic
982725989 4:158906909-158906931 AGGTGGGCATGGGAGCAAGTGGG - Exonic
984042048 4:174747172-174747194 GAGTGGCCATGTGACCTAAGAGG + Intronic
985664630 5:1175578-1175600 GTGTGGCCTTGGGACCAACCAGG - Intergenic
990502216 5:56407906-56407928 CAGTGGCCAGGGGACCAGGGTGG + Intergenic
993431258 5:87834547-87834569 GAGTGGCTATGGTACAAACTAGG - Intergenic
994263790 5:97690571-97690593 GAGTGGCAATGAGAACATGTGGG + Intergenic
997295239 5:132764788-132764810 GGGTGGTCATGGGACCAAGAGGG + Intronic
997831847 5:137157131-137157153 CAGTGCCGGTGGGACCAAGTGGG - Intronic
998001802 5:138631407-138631429 GAGCGGCCTTGGGAGCCAGTAGG + Intronic
998135056 5:139670104-139670126 GAGGGGCCATGGGGCCGAGCCGG - Intronic
999304707 5:150512009-150512031 GAGTGGCCCTGGGTGCATGTGGG + Intronic
1006440267 6:34049514-34049536 GAGTGGCCATGTGACTAGGGAGG - Intronic
1020088439 7:5323988-5324010 GAGCGGCCCTGGGACCAGGGAGG - Intronic
1024398855 7:48900076-48900098 GAATGTACATGGGACTAAGTGGG + Intergenic
1027261097 7:76465190-76465212 GTGAGGACAGGGGACCAAGTGGG + Intronic
1027312479 7:76963298-76963320 GTGAGGACAGGGGACCAAGTGGG + Intergenic
1031964296 7:128016506-128016528 GAGTGGGCATGGGGCCGTGTGGG + Intronic
1034902813 7:154917972-154917994 GAGAGGTCATGGGACCCTGTGGG + Intergenic
1036710315 8:11074314-11074336 CAGTGGCCATGGGGCCATGTGGG - Intronic
1042384358 8:68155699-68155721 GAATGGCTATGGATCCAAGTTGG - Intronic
1044830982 8:96248573-96248595 GAAAGGCCAAGGGACAAAGTAGG + Intronic
1044846071 8:96383088-96383110 GACTGGACATGTGACCAGGTTGG - Intergenic
1045695849 8:104807901-104807923 GAAAGACCATGGGACCAGGTGGG - Intronic
1046438525 8:114227898-114227920 GAGTGTACATGGTACCATGTAGG - Intergenic
1048204308 8:132403302-132403324 GAGCAGCCATGGGACCAGCTGGG - Intronic
1052764051 9:32622374-32622396 GAGTTGCCATTGGAACATGTGGG - Intergenic
1057211053 9:93201330-93201352 GAGTGGGGATGGGTCCAGGTGGG + Intronic
1057211965 9:93205386-93205408 GAGAGGCCATTGGCCCCAGTGGG + Intronic
1057474389 9:95386236-95386258 GGGTGTCCATGGGACCTGGTTGG - Intergenic
1061584255 9:131555878-131555900 GAGTGGCCAGGGGTGCAAGAGGG + Intergenic
1062063268 9:134510509-134510531 GAGTGGTGATAGGACCATGTAGG + Intergenic
1062172913 9:135145274-135145296 GAGTGGACATGACATCAAGTGGG - Intergenic
1185737463 X:2504082-2504104 GTGTGGCCAGGTGACCAAGCTGG + Intergenic
1186392581 X:9175665-9175687 GAGTGACCATGGGGCCACTTAGG - Intergenic
1191132475 X:57029616-57029638 CAGAGGGAATGGGACCAAGTTGG - Intergenic
1199595474 X:149503333-149503355 GAATGGCTATGTGACCATGTCGG - Intronic
1199598404 X:149525878-149525900 GAATGGCTATGTGACCATGTCGG + Intronic
1200385474 X:155885995-155886017 TGGTGGCTGTGGGACCAAGTGGG + Intronic
1200740512 Y:6848535-6848557 GAGTGGCCACAGGACAAAGTTGG - Intergenic
1201573858 Y:15441100-15441122 GAGTGGCCTCTGGGCCAAGTAGG + Intergenic