ID: 1096817176

View in Genome Browser
Species Human (GRCh38)
Location 12:54208885-54208907
Sequence TCCCTCCCAGGCTCGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096817176_1096817182 -4 Left 1096817176 12:54208885-54208907 CCTTACATCGAGCCTGGGAGGGA No data
Right 1096817182 12:54208904-54208926 GGGAGGGGGCCGACTCCCCCAGG No data
1096817176_1096817190 15 Left 1096817176 12:54208885-54208907 CCTTACATCGAGCCTGGGAGGGA No data
Right 1096817190 12:54208923-54208945 CAGGCATGGGCCACCTCGAAAGG No data
1096817176_1096817184 2 Left 1096817176 12:54208885-54208907 CCTTACATCGAGCCTGGGAGGGA No data
Right 1096817184 12:54208910-54208932 GGGCCGACTCCCCCAGGCATGGG No data
1096817176_1096817183 1 Left 1096817176 12:54208885-54208907 CCTTACATCGAGCCTGGGAGGGA No data
Right 1096817183 12:54208909-54208931 GGGGCCGACTCCCCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096817176 Original CRISPR TCCCTCCCAGGCTCGATGTA AGG (reversed) Intergenic
No off target data available for this crispr