ID: 1096826327

View in Genome Browser
Species Human (GRCh38)
Location 12:54280900-54280922
Sequence CTGTAGAATGGGCTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096826327_1096826332 -2 Left 1096826327 12:54280900-54280922 CCTTGCACCAGCCCATTCTACAG 0: 1
1: 0
2: 2
3: 21
4: 209
Right 1096826332 12:54280921-54280943 AGTTCCTTCGGTCGCTGCCACGG 0: 1
1: 0
2: 0
3: 7
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096826327 Original CRISPR CTGTAGAATGGGCTGGTGCA AGG (reversed) Intronic
900876740 1:5348302-5348324 CTGTGGAATAGACTGGGGCAGGG - Intergenic
901830367 1:11888448-11888470 GTGGAGAAAGGGCTGGTGCAAGG - Intergenic
903165615 1:21518378-21518400 CTGAAAAATGGGCTGGTATAAGG - Intronic
903669492 1:25027141-25027163 ATGTAGAATGGGCTGGGGAGGGG - Intergenic
904379556 1:30101750-30101772 CTGTAGAAGAGGCTGGGGAAGGG - Intergenic
904551389 1:31322148-31322170 CTGGAGAATTGGTTGGTGTAGGG - Intronic
905941203 1:41864873-41864895 CTGATGAATGGGCTGGGTCAAGG - Intronic
906038053 1:42765379-42765401 CTGTAGTAAGGGCTACTGCAAGG - Intronic
907653908 1:56322850-56322872 CTCTAGAATGGGCAGGTTCTTGG - Intergenic
907672828 1:56491939-56491961 CTGTAGGTTGGGGTGGGGCAGGG + Intergenic
908012285 1:59790989-59791011 CCCTGGAATGGGCTGGTGCTTGG - Intergenic
911090093 1:94011159-94011181 CTGTGGCAGGGGCTGGTGCTAGG - Intronic
913175083 1:116266159-116266181 CTGCAGGATGGTCTGGTGCCAGG + Intergenic
916573647 1:166048597-166048619 CTGCAGCATGAGCTGGGGCAAGG + Intergenic
917084767 1:171294379-171294401 CTGTTGCAGGGGCTTGTGCAGGG + Intergenic
918376872 1:183918203-183918225 CAGAAACATGGGCTGGTGCAAGG + Intronic
919289127 1:195605795-195605817 GTGTAGAATGAGCTGATCCAAGG - Intergenic
919757036 1:201072723-201072745 CTGGAGACTGGACTGGAGCAGGG - Intronic
922885553 1:229017944-229017966 ATGGAGACTGGGCTGATGCAGGG + Intergenic
923339068 1:232992563-232992585 CAGGACAATGGGATGGTGCAAGG + Intronic
923729459 1:236536531-236536553 CTGCAGACTGGACTGGTCCACGG + Intronic
1064166291 10:12989136-12989158 CTGAATAATGGGCAGCTGCATGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1070736541 10:78867178-78867200 CTGCAGAAGTGCCTGGTGCATGG - Intergenic
1073050225 10:100662342-100662364 ACGTAGCATGGGCTGATGCAGGG - Intergenic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1074760753 10:116665627-116665649 CTGCAGATTGTACTGGTGCAGGG + Exonic
1076366359 10:129923022-129923044 CTATAGAATGGGCTGGGTGAGGG + Intronic
1076549987 10:131272097-131272119 CGGCGGAATGAGCTGGTGCAGGG + Intronic
1077345223 11:2045233-2045255 ATGGAGAATGGACTGGTGCATGG - Intergenic
1079035434 11:17015529-17015551 CTGTAGGATGGGGTGGGGCACGG + Intergenic
1081103049 11:39028958-39028980 CTGGAGCTTGAGCTGGTGCAGGG + Intergenic
1081730438 11:45368425-45368447 CTGTAGAATGGGTGGGTGAATGG - Intergenic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1085413769 11:76307051-76307073 CTGCTGAGTGGGCAGGTGCAGGG - Intergenic
1088598588 11:111457142-111457164 CTGCAGGATGGGCAGGTGCGTGG - Intronic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1092087233 12:5773132-5773154 CTGTAGCCGGAGCTGGTGCATGG - Intronic
1096143848 12:49264757-49264779 CTGGAGAATGGGCCGGGACAGGG - Intronic
1096316770 12:50574752-50574774 ATGAAGAATGGGTTGGTGCCAGG + Intronic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1098272594 12:68783372-68783394 CTGTAAAATGGGTTGTTACAAGG - Intronic
1098342193 12:69463773-69463795 GAGAAGAATGGGCTGGGGCATGG + Intergenic
1102062963 12:109948375-109948397 CTCTAAAATGGGGTGGTGCCAGG - Intronic
1102564109 12:113783427-113783449 CTCTAGAATGTGCTGGGGCATGG - Intergenic
1103079355 12:118011083-118011105 CTGTAAAATGGGCAGGGGTAGGG - Intergenic
1104861715 12:131927597-131927619 CTGGAGCCTGGGCTGGTGGAGGG + Intergenic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1111707894 13:91774482-91774504 GTGAAGGATGGGCTGGTGCAGGG + Intronic
1118636527 14:67753248-67753270 CTGGAGCAGGGGCTGGAGCAGGG - Intronic
1119300649 14:73569020-73569042 CTGCGGAATGGGCTGGACCAGGG - Intronic
1120465240 14:84848325-84848347 CCGGTGAATGGGCTGTTGCATGG + Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121522190 14:94593767-94593789 ATCTGGCATGGGCTGGTGCATGG - Intronic
1123917810 15:25050138-25050160 CTGCAGGATGGGATGGTGCCTGG + Intergenic
1124383776 15:29189315-29189337 CTGGAGAATGGTTTGGTGTATGG + Intronic
1124700648 15:31909188-31909210 CTGAAGGCTGGGCTGGGGCAGGG + Intergenic
1128917008 15:71572402-71572424 CTGTAGTAGTGGCTGTTGCAAGG + Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1130754912 15:86752971-86752993 CTGAAGAAAGGGCGGGAGCAAGG - Intronic
1133138397 16:3728156-3728178 CTGCAGAATCCGCTGCTGCAGGG + Exonic
1136543556 16:30942558-30942580 CTGGAGAATGGGCTGGGCAAGGG + Intronic
1138162294 16:54765681-54765703 AAATGGAATGGGCTGGTGCATGG + Intergenic
1138376779 16:56569657-56569679 CTGTTTAATGGGCTTGAGCATGG + Intergenic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1140211129 16:72971421-72971443 CTGTAAAGTGGGCTGCCGCAAGG - Intronic
1141159086 16:81617288-81617310 CTGGAGAATGGCCTGGAGCTGGG + Intronic
1142551259 17:741439-741461 CAGTAGAATGGGATGCTGAAGGG - Exonic
1143405768 17:6676460-6676482 GTGTAGAAGGAACTGGTGCAAGG - Intergenic
1143686760 17:8523628-8523650 CTGCAGAATGGCCTGGGGAAGGG + Intronic
1145018114 17:19411947-19411969 CTGTAGCATGGGGTTGTGGAGGG + Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1148074438 17:44927379-44927401 CTATGGAATGGGCGGGTGCGTGG + Intronic
1148150609 17:45394728-45394750 CTGTAAAATGGGATGGTGTGTGG + Exonic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148804764 17:50258649-50258671 CTGTAAAATGGGATGGGGCCAGG - Intergenic
1150550104 17:66202359-66202381 TTGTAGAATAGGCTGGGGAAGGG + Intergenic
1152926027 17:83088167-83088189 CTGCAGAGGCGGCTGGTGCAGGG - Intronic
1153359842 18:4181987-4182009 CTGAAAAATAGGCTGGAGCAGGG - Intronic
1157723662 18:49945725-49945747 GAGCAGAATGGGCTGGTGGAGGG + Intronic
1158395673 18:57077103-57077125 CTGGAGAGTGAGCTGCTGCAGGG + Intergenic
1160542271 18:79630587-79630609 CTGTAGAATGGAGTGGTCGATGG - Intergenic
1160598873 18:79997341-79997363 CTGTTGCAGGGGCTTGTGCAGGG - Intronic
1160602829 18:80027276-80027298 CTGTTGCAGGGGCTTGTGCAGGG - Intronic
1160823657 19:1069474-1069496 CTGTAAAATGGGCGGCTGCTGGG - Intronic
1161708777 19:5835297-5835319 CTGTAGAATGGACAGCTGTAGGG - Intronic
1162508879 19:11105152-11105174 CTATAGAATGGGCTGGTGTTGGG + Intronic
1164079480 19:21850260-21850282 CTGTAGAAAGGGCCTGGGCAGGG + Intronic
1167148289 19:47695146-47695168 AGGGAGAATGGGCTGGGGCAGGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925823890 2:7828022-7828044 CTGTAGGATGGACTGGGCCAGGG - Intergenic
926285706 2:11486003-11486025 CTGTGGGATGGGCTGGTGACAGG + Intergenic
927719134 2:25372083-25372105 CTGTAGACCGGGCTGGGGTAAGG + Intergenic
927773083 2:25880536-25880558 CTGTAGGATGGGCTTGAGTAGGG - Intergenic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929545519 2:42853075-42853097 TCGTAGACTGGGCTGGAGCATGG + Intergenic
929576540 2:43056090-43056112 CTGCATCATGGGCTGGTGAAGGG + Intergenic
930842165 2:55859555-55859577 CCTTGGAAGGGGCTGGTGCAAGG + Intergenic
930869418 2:56154655-56154677 CACTAGAATGGCCTGGAGCAGGG + Intergenic
931023866 2:58085342-58085364 TTGTAGAATGGATTGGGGCAAGG + Intronic
932207038 2:69892414-69892436 GTGTAGAATGGGGAGGTTCAAGG - Intergenic
932619439 2:73257138-73257160 CTGAGGACAGGGCTGGTGCAGGG + Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
934299728 2:91769766-91769788 CTGTGGATTGGGGTGGGGCAGGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935914289 2:107932529-107932551 CTGTTGAATGGGCAGGCTCATGG + Intergenic
938728060 2:134124097-134124119 CTGTGCACTGGGCTGGTGCTGGG + Intronic
940388235 2:153099855-153099877 CTGTAGAATTGACTGGGGCTAGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
945636254 2:212355340-212355362 CTTTAGAATGAGCTTCTGCATGG + Intronic
948437247 2:237962015-237962037 CTCTGGCCTGGGCTGGTGCAGGG - Intergenic
1168845000 20:938353-938375 CTGTAAAATGGGCTAGTGTGTGG - Intergenic
1169698427 20:8418343-8418365 CTGAAGGTTGGGCTGGTGCTAGG - Intronic
1171848866 20:30294095-30294117 CTGTAGGAGGGCCTGGTGCTAGG - Intergenic
1172287178 20:33749032-33749054 CTGGGGCATGGGCTGGTCCAGGG - Exonic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1173912773 20:46682633-46682655 CTGTAAAATGGGTTAATGCATGG + Intronic
1175592435 20:60203808-60203830 CTGATGAGTGGGCTGGGGCAGGG - Intergenic
1176032006 20:63017267-63017289 CTGAAGAAGGGGGTGGTGCCTGG + Intergenic
1176686814 21:9856334-9856356 CTTTAGAAAAGGCAGGTGCATGG - Intergenic
1178459401 21:32788676-32788698 TTGAAGAATGGGCTACTGCATGG + Intergenic
1179604011 21:42500426-42500448 CTGTAAAATGGGCTGTTGTGAGG + Intronic
1181283783 22:21737665-21737687 AAGTAGAATGGGGTGGTGCGGGG - Intergenic
1181556266 22:23673427-23673449 CTGTGGATTGGGGTGGGGCAGGG - Intergenic
1181698083 22:24603862-24603884 CTGTGGATTGGGGTGGGGCAGGG + Intronic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1183426000 22:37739706-37739728 CTGTGGAATGGGCGGGGACAGGG + Intronic
1184596552 22:45517456-45517478 CTGTAGCCTGGGCTGGGGCATGG + Intronic
1184642252 22:45878928-45878950 CTGTGGAATGGGCCGGGGCAGGG + Intergenic
950682591 3:14595375-14595397 CTGAAGAGTGTGCTGGAGCAGGG - Intergenic
950830866 3:15874783-15874805 GTTGATAATGGGCTGGTGCAGGG + Intergenic
951379858 3:21969599-21969621 CTTTGGAATGGCCTGGTGCCAGG + Intronic
953742219 3:45547687-45547709 CTGTAGTGTGGCCTGGTGCTGGG + Exonic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954155451 3:48682670-48682692 CTGTAGGCTGGGGTGGAGCATGG - Intronic
954706650 3:52484576-52484598 CTGGGCAATGGGCTGGTGCTCGG - Exonic
954714993 3:52522532-52522554 CTGCAGAATGGAGGGGTGCATGG - Intronic
954882156 3:53843818-53843840 CTGTAAAATGGGGTGGTGATAGG - Intronic
954914498 3:54137139-54137161 CTGAAGCATGGGCTGGCACAGGG + Intronic
955867444 3:63400023-63400045 CTGCAGAATGGGCTGGGGACTGG - Intronic
964846473 3:161049616-161049638 CTGTAGAATGGGATAGGGGATGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
967913863 3:194563692-194563714 CTGGAGAATGAGCAGGTGCGTGG - Intergenic
968494049 4:905709-905731 CCGTAGCATGGCCTGGGGCATGG - Intronic
968661826 4:1801841-1801863 CTGCAGGATGGGCCGGTGCGGGG - Exonic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
969557965 4:7926395-7926417 TTGTAGGATGGGGTGGGGCAGGG - Intronic
969687270 4:8682702-8682724 CTCTTGAATGGGCTGCTGCCAGG - Intergenic
971626385 4:28925517-28925539 GTGTATAATGGTCTCGTGCATGG + Intergenic
973239715 4:47944678-47944700 ATGTGGAATGGGCTGGTGAGAGG + Intronic
974406786 4:61482852-61482874 CTCTAGAATGGGTTGCTGCTTGG + Intronic
975695291 4:77007025-77007047 CTGTACATTGTGCTGGGGCAGGG + Intronic
975991045 4:80260796-80260818 CCTTTGAATGGGCTGGTGAATGG + Intergenic
976544568 4:86319700-86319722 CTTCAGAATGGGCTTGTTCAAGG - Intronic
980350204 4:131674480-131674502 CTTTAGAAAAGGCAGGTGCATGG - Intergenic
980439431 4:132820491-132820513 CTTTAGAATCAGCTAGTGCAGGG - Intergenic
984904133 4:184611185-184611207 CTGTAGAATTGCTTGGTGCGTGG - Intergenic
986175621 5:5349685-5349707 CTGTGGAGTGGGCTAGTACAGGG + Intergenic
988864939 5:35324440-35324462 CTGGTGCATGGGTTGGTGCATGG - Intergenic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996994401 5:129677759-129677781 GTGGAAAATGGGCTGGTGTAGGG - Intronic
997449157 5:133968123-133968145 TTGAAGAATGGGCTGCCGCAAGG - Intronic
998461881 5:142315718-142315740 CTGTAAAATGGGCTCTTGCAAGG + Intronic
999409156 5:151335295-151335317 CAGTGGAGTGGGCAGGTGCATGG + Intronic
1001828707 5:174767428-174767450 CTGTAGAAGGTGCTGCTCCAAGG - Intergenic
1002132905 5:177092327-177092349 CTGCAGGATGGGCCGGTGCGGGG - Exonic
1003069318 6:2932202-2932224 CTGCAGAAATGGCTGTTGCATGG + Intergenic
1004168351 6:13276206-13276228 CTGTAGGGTAGGCTGGAGCAGGG + Intronic
1006511136 6:34521813-34521835 CTGTAAAATGGGCTGTTGCAAGG - Intronic
1008456928 6:51721906-51721928 GTGAAGAATGGGTTGGAGCATGG - Intronic
1008906841 6:56687060-56687082 CTGTAGAAGGAGGTGGTCCATGG - Intronic
1013170577 6:107634193-107634215 CGATAGCATGGGCCGGTGCATGG - Exonic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1014720961 6:124917858-124917880 CTGTAGAATGTGCTGGGATAAGG + Intergenic
1015731008 6:136348321-136348343 AGGTAGAATGGGCAGGTGGAGGG - Intronic
1016437663 6:144054199-144054221 CTGAAGAATGGACTGTTGTAGGG - Intronic
1017195003 6:151690603-151690625 CTATAGAATGGGCAGGAGAAAGG - Exonic
1019510145 7:1413743-1413765 CTGTACAATGGGTTGGGGCGGGG + Intergenic
1024407219 7:48995615-48995637 GTGTTGACAGGGCTGGTGCAGGG - Intergenic
1024529646 7:50380697-50380719 AAGTAGAGTGAGCTGGTGCAGGG - Intronic
1027192152 7:76002965-76002987 CTGTACCAGGGGCTGGAGCATGG - Intronic
1027220956 7:76213629-76213651 CTGTAGGATGGGCTGAAGGATGG + Intronic
1027562047 7:79742586-79742608 CAGTAGAATGGGCTGGGGTTTGG - Intergenic
1029465421 7:100721711-100721733 CTGTGGAATGTGCTGGGGAAGGG - Intronic
1034759427 7:153657462-153657484 CAGGTGTATGGGCTGGTGCAAGG + Intergenic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035812220 8:2502062-2502084 CTGTAGAATGCACTCCTGCAGGG - Intergenic
1035812228 8:2502110-2502132 CTGTAGAATGCACTCCTGCAGGG - Intergenic
1035812236 8:2502158-2502180 CTGTAGAATGTACTCCTGCAGGG - Intergenic
1035812242 8:2502206-2502228 CTGTAGAATGCACTCCTGCAGGG - Intergenic
1035812249 8:2502254-2502276 CTGTAGAATGCACTCCTGCAGGG - Intergenic
1036680767 8:10871614-10871636 CTGCAGAGTGGGCTGGTCCTTGG - Intergenic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1038612521 8:29069355-29069377 CTGGCGGCTGGGCTGGTGCAGGG - Exonic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1041875642 8:62683890-62683912 CTGTTGACCTGGCTGGTGCATGG + Intronic
1047286953 8:123495633-123495655 CTGTGGACTGGGCGGGTGCGGGG + Intergenic
1048549371 8:135420243-135420265 CTTTACTATGGTCTGGTGCACGG - Intergenic
1049249099 8:141578646-141578668 CTTCAGAATGGGCTGGTGGAAGG - Intergenic
1049254758 8:141607869-141607891 CGGCAGTATGGGCTGCTGCAAGG + Intergenic
1052175582 9:25458746-25458768 CTGTAGAATGGACTGCTGAAGGG - Intergenic
1053782507 9:41625230-41625252 CTTTAGAAAAGGCAGGTGCATGG + Intergenic
1053786577 9:41656815-41656837 CTGTAGGAGGGCCTGGTGCTAGG - Intergenic
1054158483 9:61657380-61657402 CTGTAGGAGGGCCTGGTGCTAGG + Intergenic
1054170463 9:61835387-61835409 CTTTAGAAAAGGCAGGTGCATGG + Intergenic
1054175302 9:61870830-61870852 CTGTAGGAGGGCCTGGTGCTAGG - Intergenic
1054450265 9:65400036-65400058 CTGTAGGAGGGCCTGGTGCTAGG - Intergenic
1054478256 9:65588385-65588407 CTGTAGGAGGGCCTGGTGCTAGG + Intergenic
1054662235 9:67709980-67710002 CTGTAGGAGGGCCTGGTGCTAGG + Intergenic
1054667074 9:67745428-67745450 CTTTAGAAAAGGCAGGTGCATGG - Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057142634 9:92736883-92736905 CTGTAGCGTGGGATGGTGCAGGG + Intronic
1057824921 9:98365024-98365046 TTGTAAAATGGGCAGGGGCAGGG + Intronic
1060487019 9:124054290-124054312 CTGTGCAATGGGCTAGTGCATGG + Intergenic
1060966153 9:127713331-127713353 CTGTAAAATGGGCTGAAGAAAGG + Intronic
1061541684 9:131280895-131280917 CTGTAGAATGGGATGATGACAGG - Intergenic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1062426482 9:136508477-136508499 CTGTAGAATGGGTTGCAGCCTGG - Intronic
1185933617 X:4230718-4230740 CTGAACAATGGGCAGATGCAAGG - Intergenic
1189322705 X:40096313-40096335 GTGTAGAATGTGCTTGTGCGGGG - Intronic
1190399084 X:50013764-50013786 CAGTGCAATGGGCTTGTGCAAGG + Intronic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1191861781 X:65671549-65671571 CTGTAGGCAGGGCTGGTTCAAGG - Intronic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1197181134 X:123538730-123538752 CTGTAGACGGGCCTGCTGCAAGG + Intergenic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic