ID: 1096826975

View in Genome Browser
Species Human (GRCh38)
Location 12:54286943-54286965
Sequence CACAAGGACGTTCCTGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096826975 Original CRISPR CACAAGGACGTTCCTGCAAA AGG (reversed) Intronic
903137178 1:21317318-21317340 AACAAGGTCGTGTCTGCAAAGGG + Intronic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
913728817 1:121686632-121686654 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913729267 1:121692226-121692248 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913748235 1:121931195-121931217 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913748386 1:121933060-121933082 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913748774 1:121937861-121937883 CACAAGGAAGTTCCTGAGCATGG + Intergenic
913767163 1:122204848-122204870 CACAAGGAAGTTCCTGAGCATGG - Intergenic
916532714 1:165673504-165673526 CAGAAAGATGTTACTGCAAAGGG - Intronic
921857600 1:220003847-220003869 CACAAGGCCATTCCAGGAAAAGG + Intronic
922035771 1:221846394-221846416 CACAACGACATCCATGCAAAAGG + Intergenic
923741272 1:236657266-236657288 CACAAGGACGTACTTGCTAAGGG - Intergenic
1062910990 10:1212425-1212447 CACAAGTACCTTCTTGCCAAAGG + Intronic
1067188641 10:44051577-44051599 TTCAAGGCCGTTACTGCAAATGG - Intergenic
1068224500 10:54089671-54089693 GACAAGGACATTACTACAAAGGG - Intronic
1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG + Intergenic
1071558035 10:86621211-86621233 CACAAAGACATTCCATCAAAAGG - Intergenic
1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG + Intronic
1077453424 11:2664261-2664283 AACAAGGAGGTTGCTGCAAAGGG + Intronic
1081584881 11:44377329-44377351 CTCAAGAACTTTCCTGCACATGG + Intergenic
1082316504 11:50731358-50731380 CACAAGGAAGTTTCTGAGAATGG + Intergenic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1091411229 12:240833-240855 CACAAAGACGTGCCTGGAAGGGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1102934858 12:116887817-116887839 TACAAGGACGTCCCTGGAGAAGG - Intergenic
1105129405 13:16916977-16916999 CACAAGGAAGTTTCTGAGAATGG - Intergenic
1113931822 13:113972776-113972798 CACCAGGGCCTTCTTGCAAACGG + Intergenic
1117575516 14:57093271-57093293 CACAAGGAGGATCCAGCAAAGGG + Intergenic
1124388087 15:29226392-29226414 CAGAATGATGTTCCTACAAACGG + Intronic
1127691037 15:61398161-61398183 CACAAAGATCTTCCTGGAAAGGG + Intergenic
1131798658 15:96046842-96046864 CACAAGGAAATACCTCCAAAAGG + Intergenic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1132506735 16:313819-313841 AACAAGCACGTTCCTACACATGG + Intronic
1132981912 16:2742632-2742654 CACCAGCAGGTCCCTGCAAAGGG - Intergenic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG + Intronic
1137644129 16:50059509-50059531 CCCAAGGAAGTCACTGCAAAGGG - Intergenic
1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG + Intronic
1148233721 17:45953306-45953328 CTCAAGGATGCTCCTGAAAATGG + Intronic
1148786972 17:50150321-50150343 CAAAAGTATGTTCCTGCAGATGG - Exonic
1151303922 17:73250785-73250807 GACAAGACTGTTCCTGCAAAAGG - Intronic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1155522576 18:26684015-26684037 CACATACACCTTCCTGCAAATGG + Intergenic
1158025191 18:52887432-52887454 CAAAAGGTAGTTCCAGCAAAAGG + Intronic
1158070386 18:53463056-53463078 AATATGGAGGTTCCTGCAAAAGG - Intronic
1160484381 18:79275470-79275492 GCTAAGGACATTCCTGCAAATGG - Intronic
1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163406448 19:17126038-17126060 CACAAGGAAGACCCTGCGAAGGG - Intronic
1164346393 19:27266169-27266191 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1164497267 19:28777845-28777867 CACAAGTACATTCCTCCAATAGG + Intergenic
1167218977 19:48184986-48185008 CACAGGGACAATCCTGCAGAGGG - Intronic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
925343029 2:3149759-3149781 CTCCTGGACGTTCCTGCCAAGGG + Intergenic
941093348 2:161205586-161205608 TACAAGGACGTTCATGCCATGGG + Intronic
941317457 2:164011468-164011490 CACAAAGACATTTCTCCAAATGG + Intergenic
1177006999 21:15685944-15685966 GAGAAGGAAGCTCCTGCAAATGG + Intergenic
1177352898 21:19967918-19967940 CACAAGGTTGTTCCTTCTAAAGG - Intergenic
1179024837 21:37671349-37671371 CACATGGATGTTCCTGGAAGGGG + Intronic
951305141 3:21050976-21050998 GACAAGGACCGACCTGCAAATGG - Intergenic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG + Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
958205056 3:90380718-90380740 CACAAGGAAGTTTCTGAGAATGG + Intergenic
960607253 3:119519411-119519433 GAAAAGGATGTTCATGCAAATGG + Intronic
961506945 3:127376283-127376305 CACAAGAGAGTTCCTGCCAATGG + Intergenic
963546683 3:146668356-146668378 CACATGCATGTTTCTGCAAAAGG + Intergenic
967183056 3:186923042-186923064 CACAAAGAAATTCCTCCAAAGGG - Intergenic
968266289 3:197366025-197366047 CACCAGGTCATTCCTGCACAAGG - Intergenic
973616719 4:52686180-52686202 GACAAGGATGTTCCAACAAAAGG - Intergenic
974523237 4:63012845-63012867 AAGCAGGACGTTCCTGCATAAGG + Intergenic
977718357 4:100209426-100209448 CACATGGAGGTTCCTGGAAGGGG + Intergenic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG + Intergenic
983709124 4:170692987-170693009 CACATGGAGGTTCCTGGAGAGGG - Intergenic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
988490086 5:31698787-31698809 CACGAGGAAGTACCTGCACAAGG + Intronic
989638983 5:43565133-43565155 CAGAAAGACGTTACTGGAAAGGG - Intergenic
989841532 5:46079035-46079057 CACAAGGAAGTTTCTCAAAAAGG - Intergenic
999037878 5:148373844-148373866 CACAATGACTGTCCTGCATAGGG + Intergenic
999845849 5:155479376-155479398 CACAAGGCCGTTCCAGAGAAAGG - Intergenic
1001956229 5:175849899-175849921 CACACGGTCGTTCCCCCAAAGGG - Intronic
1002045585 5:176540027-176540049 CACAAGCAGCTTCCTGTAAAAGG - Intergenic
1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG + Intergenic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1005609222 6:27507491-27507513 CACCAGGAAGCTCGTGCAAATGG + Intergenic
1012979755 6:105816991-105817013 CACATGAGCGTTCCTGGAAATGG - Intergenic
1014258281 6:119186203-119186225 CCCAAGGACTTTCCAGCAAAGGG - Intronic
1021263321 7:18486379-18486401 CATAAGGCCCTTCCTTCAAAAGG + Intronic
1021294587 7:18888848-18888870 GACAAAGTCGTTCCTGAAAAAGG - Intronic
1022414706 7:30167973-30167995 CAGAAGGACGTTCCTGTAGGAGG + Intergenic
1022708294 7:32827250-32827272 CCCATGGAAGTTCCTGCGAAGGG - Intergenic
1033658845 7:143390379-143390401 CACTAGGACCTTCCTGCAAGAGG - Intronic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1038264556 8:26028223-26028245 CACAATGACCTTCATTCAAAAGG - Intronic
1042446917 8:68895339-68895361 CTTAAGGACGTTCCTGCTACAGG + Intergenic
1045428100 8:102087217-102087239 CAGAAGGATGTTACTGGAAAGGG - Intronic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1053711744 9:40818652-40818674 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1053991303 9:44082941-44082963 CACAAAGAAGTTCCTGAGAATGG - Intergenic
1054032058 9:44788341-44788363 CACAAAGAAGTTCCTGAGAATGG - Intergenic
1054422209 9:64950530-64950552 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1057626911 9:96686172-96686194 CACAAAGAGCTTCCTGCAAGTGG - Intergenic
1059557675 9:115297747-115297769 AACAAGTACGTTCATGCAGATGG - Intronic
1187176186 X:16898167-16898189 CACCCGGACATTCCTGCAGAAGG - Intergenic
1189442073 X:41046240-41046262 CAGAAGGAGCTCCCTGCAAAGGG - Intergenic
1194438961 X:93905890-93905912 CTGAAGGAGGTTCCTGAAAAAGG - Intergenic
1202062090 Y:20898827-20898849 CACATGGACATTGCTTCAAATGG + Intergenic