ID: 1096829081

View in Genome Browser
Species Human (GRCh38)
Location 12:54300716-54300738
Sequence GGGGGGTGAAGGAGGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2058
Summary {0: 1, 1: 1, 2: 20, 3: 228, 4: 1808}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096829081_1096829093 1 Left 1096829081 12:54300716-54300738 CCCCCTCACCTCCTTCACCCCCC 0: 1
1: 1
2: 20
3: 228
4: 1808
Right 1096829093 12:54300740-54300762 GCCTGCCCCTCGGATCTCACTGG 0: 1
1: 0
2: 2
3: 13
4: 120
1096829081_1096829087 -9 Left 1096829081 12:54300716-54300738 CCCCCTCACCTCCTTCACCCCCC 0: 1
1: 1
2: 20
3: 228
4: 1808
Right 1096829087 12:54300730-54300752 TCACCCCCCAGCCTGCCCCTCGG 0: 1
1: 0
2: 7
3: 55
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096829081 Original CRISPR GGGGGGTGAAGGAGGTGAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr