ID: 1096838120

View in Genome Browser
Species Human (GRCh38)
Location 12:54364153-54364175
Sequence CTGGGTTTACTGAGAGCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096838120_1096838129 25 Left 1096838120 12:54364153-54364175 CCCGCTGCTCTCAGTAAACCCAG 0: 1
1: 0
2: 2
3: 21
4: 205
Right 1096838129 12:54364201-54364223 CCCCATCCCCAAAGACCCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096838120 Original CRISPR CTGGGTTTACTGAGAGCAGC GGG (reversed) Exonic
901208744 1:7512577-7512599 CTTGGTTTTCTGAGAGCAGAAGG + Intronic
901466106 1:9422181-9422203 ATGGCTTTGCAGAGAGCAGCCGG - Intergenic
901931212 1:12596927-12596949 CTGGGTTTATTGTGAGAAGCCGG + Intronic
901935014 1:12620841-12620863 CTGGCTTCAGTGAGAACAGCAGG + Intergenic
902462932 1:16592624-16592646 CTGTTTTAACTGAGAGCAGGTGG - Intronic
903007545 1:20308677-20308699 TTGGGCTGACTGACAGCAGCAGG - Intronic
903158585 1:21468108-21468130 CTGTTTTAACTGAGAGCAGGTGG + Intronic
903377595 1:22876475-22876497 TGGGGTTCACTGAGGGCAGCAGG + Intronic
903926761 1:26835951-26835973 CTGGGTAAACTGGGAGGAGCTGG - Intronic
903973754 1:27136286-27136308 CTGGGTCTGCTGGGAGCAGGGGG + Intronic
904038228 1:27570089-27570111 CTGGGCTTCCTGAGACCCGCTGG - Intronic
904596684 1:31650940-31650962 CAGGGTTAACTGAGAATAGCTGG + Intergenic
905212015 1:36380896-36380918 CAGGGTTTACTGAACGAAGCTGG + Intronic
906084887 1:43123192-43123214 GTGGGTGTACTGAGAAAAGCAGG + Intergenic
906294471 1:44640904-44640926 CTGGTTTTGTTGGGAGCAGCAGG + Intronic
908595415 1:65684084-65684106 ATGGGTTTCCTGAGTACAGCAGG + Intergenic
908928286 1:69284037-69284059 CTTGTCTTACTGAGAGCAGTAGG + Intergenic
909054734 1:70807364-70807386 CTGGGTTCCCTGAGAGCACAGGG + Intergenic
909767845 1:79379886-79379908 CTTGATTAACTGACAGCAGCTGG - Intergenic
910275730 1:85447162-85447184 GTGGGTTTGCTTAGAGCAGCAGG - Intronic
912207561 1:107525103-107525125 CTGGCTCTACTGAGAGAAGTGGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913111191 1:115658718-115658740 CTGGGTTTCCTGTTGGCAGCTGG + Intronic
913167263 1:116199774-116199796 CTGCTTGTACTGAGAGAAGCAGG - Intergenic
913640143 1:120804965-120804987 CTGTTTTAACTGAGAGCAGGTGG + Intergenic
914202064 1:145494172-145494194 CTGGATTAACTGAGACCTGCAGG - Intergenic
914212370 1:145591663-145591685 CTGTTTTAACTGAGAGCAGGTGG - Intergenic
914235992 1:145812082-145812104 CTGGATTAACTGAGACCTGCAGG - Intronic
914278331 1:146145372-146145394 CTGTTTTAACTGAGAGCAGGTGG - Intronic
914481186 1:148067314-148067336 CTGGATTAACTGAGACCTGCAGG - Intergenic
914539378 1:148596320-148596342 CTGTTTTAACTGAGAGCAGGTGG - Intronic
914627301 1:149475308-149475330 CTGTTTTAACTGAGAGCAGGTGG + Intergenic
915121093 1:153629906-153629928 CTGAGTTTCCTGTCAGCAGCTGG - Intronic
915446875 1:155978953-155978975 CTGGGTTTTCTAAGAGCTGGGGG - Intronic
916153003 1:161814322-161814344 GTGGCTTTGCTGAGAGCATCTGG + Intronic
916278568 1:163023500-163023522 CTGGGTTCACTGGGATGAGCTGG + Intergenic
916712861 1:167427439-167427461 CTGGGGTTCCTGAGAGCACTTGG - Intergenic
919368903 1:196700899-196700921 GTGAGTTTTCTCAGAGCAGCTGG + Intronic
919381531 1:196867252-196867274 GTGAGTTTTCTCAGAGCAGCTGG + Intronic
919547451 1:198941179-198941201 CTGGGCTTTCTAAGAGCTGCTGG + Intergenic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
920188577 1:204177920-204177942 TAGGGTTTGCTGAGAGCAGAGGG - Intergenic
922185404 1:223270038-223270060 CTGGGTTTACTGGGAGAAATGGG + Intronic
922467266 1:225852932-225852954 CTGGGTGCACTGAGTGAAGCAGG - Intronic
1066318903 10:34279662-34279684 CAGGTATTACTGAGAACAGCTGG + Intronic
1068963512 10:62888912-62888934 CTGTGTGTACTGAGAGCACCTGG + Intronic
1071036858 10:81258116-81258138 CTGGATTTACTGAGAGGTGGAGG + Intergenic
1071895095 10:90057676-90057698 GTGGGTTTACTGGGTTCAGCTGG - Intergenic
1073668651 10:105562361-105562383 CTGGGTCTTCTGGGAGCAGTGGG + Intergenic
1074870196 10:117570112-117570134 CAGGGTTTCCTGAGAGGAGCTGG - Intergenic
1075016118 10:118911000-118911022 CTAGGCTTAGTGAGAGGAGCAGG - Intergenic
1075398504 10:122144487-122144509 CTGGGTGTGCTGAGAACGGCAGG + Intronic
1076424627 10:130358898-130358920 CTGGGCTTTCTGAGAGCTCCTGG + Intergenic
1077753660 11:5002511-5002533 CTGGACTTACTGCCAGCAGCTGG - Intergenic
1080058765 11:27934615-27934637 CTGGGTTTAGTTAGAGGAGAAGG + Intergenic
1080155348 11:29104460-29104482 TTGGCTTTACTGTGAGCAGATGG - Intergenic
1083274095 11:61587275-61587297 CTGGGCTCCCTGAGAGGAGCGGG - Intergenic
1083822875 11:65182517-65182539 CTGGATTCACTGGGAGCACCGGG + Exonic
1083832743 11:65243330-65243352 CTGGGATTACAGAGAGGAGAAGG + Intergenic
1086921892 11:92596766-92596788 TTGGCCTTACTGAGAGAAGCAGG - Intronic
1087046076 11:93845021-93845043 TTGGGTGTTCTGAGAACAGCAGG + Intronic
1088754791 11:112876746-112876768 CTGGCTTTACTGAGAGTGCCTGG - Intergenic
1089043991 11:115483045-115483067 CTGGATTTACTGACATCAGTTGG - Intronic
1091846054 12:3657089-3657111 CTGGCTCTGCTGAGAGCATCAGG - Intronic
1091921681 12:4309693-4309715 CTGAGTTTACTGTGAGTTGCTGG - Intergenic
1092037957 12:5357004-5357026 CTGGGATTTCTGAGAGAGGCAGG - Intergenic
1092165037 12:6337187-6337209 CTGGGCTTACTGGGGCCAGCTGG - Intronic
1096838120 12:54364153-54364175 CTGGGTTTACTGAGAGCAGCGGG - Exonic
1099297389 12:80845732-80845754 CTCCGTTCACTGATAGCAGCTGG + Exonic
1100089801 12:90955122-90955144 CTGGGTTGAGAGGGAGCAGCAGG - Exonic
1101805787 12:108062405-108062427 CTGGGGCACCTGAGAGCAGCAGG - Intergenic
1102358091 12:112257369-112257391 CTGGGTTTCTCTAGAGCAGCAGG - Intronic
1102856913 12:116302245-116302267 TTGGGATTTCTGAGAGGAGCGGG + Intergenic
1104938875 12:132385158-132385180 CTGTGTTTACTGGGAGCACCGGG + Intergenic
1106139933 13:27003723-27003745 CAGGGTTTTCTGAGAGGAGGAGG - Intergenic
1106472491 13:30069872-30069894 CTGGCATTTCTGAGAGCAGCTGG - Intergenic
1108150873 13:47532259-47532281 TGGGGTTTACTGAGAGCCTCAGG - Intergenic
1110535339 13:76645106-76645128 CTGGGTTGAATGATTGCAGCTGG + Intergenic
1112897011 13:104311535-104311557 CTGGGGTTACTGAAAACAGAAGG - Intergenic
1114786290 14:25603576-25603598 GTGGGGTTTCTGAGACCAGCTGG + Intergenic
1115309622 14:31966160-31966182 CTGGGCTGACTGAGATCATCAGG - Intergenic
1116577388 14:46591778-46591800 CTGGGTTCAAGGAGAGTAGCTGG - Intergenic
1117288143 14:54307264-54307286 CTGGTTTTACAGGAAGCAGCTGG - Intergenic
1117881287 14:60315907-60315929 TTGTGATTACTGTGAGCAGCAGG + Intergenic
1118726384 14:68631967-68631989 GAGGGTTTACTGAGTGAAGCAGG + Intronic
1119122903 14:72096578-72096600 GTGGGTTGACTGAGCTCAGCCGG + Intronic
1120657218 14:87206219-87206241 CTGGGTTCACTGACAGCACATGG - Intergenic
1122535348 14:102458168-102458190 CAGAATTTACTGGGAGCAGCAGG - Intronic
1122878258 14:104678652-104678674 AGGGGCTTACAGAGAGCAGCTGG - Intergenic
1127067691 15:55257486-55257508 CTGAGTTTAATCAGAGCAGCAGG - Intronic
1127480413 15:59372330-59372352 CCGGGTTTACGGAAAGCGGCAGG + Intronic
1132739356 16:1403781-1403803 CTGGGGTCCCTGAAAGCAGCAGG - Intronic
1133684091 16:8149396-8149418 CTGGCTTGGCTGAGAGCAGGTGG - Intergenic
1133720901 16:8493432-8493454 CTGGGCTTAATCACAGCAGCAGG + Intergenic
1133749676 16:8714727-8714749 CAGGGTTCACTTAGAGCAACCGG - Intronic
1134507894 16:14822998-14823020 CTGTGCTTCCTGAGAACAGCAGG - Intronic
1134695595 16:16221761-16221783 CTGTGCTTCCTGAGAACAGCAGG - Exonic
1134976234 16:18572925-18572947 CTGTGCTTCCTGAGAACAGCAGG + Intergenic
1135590968 16:23705094-23705116 CTGGGTCCACAGTGAGCAGCAGG + Exonic
1136558859 16:31026342-31026364 CTCGGCTTACTGAGAGTAACTGG - Intergenic
1137730772 16:50688005-50688027 GTGGGAGTACTGAGAGCTGCGGG + Intergenic
1138557598 16:57781573-57781595 TTGTATTTACTGAGAGCAGTTGG - Intronic
1139945098 16:70635397-70635419 TTGTGCTTCCTGAGAGCAGCAGG - Intronic
1141596656 16:85101082-85101104 CTGGGCTTCCTCACAGCAGCTGG - Intronic
1141871668 16:86790656-86790678 CTGGGTTTATCAAGAGCAGCAGG + Intergenic
1141994037 16:87625770-87625792 CGGGGTTTACTGCGAGCCGTGGG + Intronic
1142303788 16:89274434-89274456 CTGGGGTGCCTGAGAGCAGCAGG + Intronic
1142311040 16:89313906-89313928 CTGGCTTTACTGTGAGTAGTTGG + Intronic
1143681199 17:8477215-8477237 CTAGCTTTGCTGAGAGCGGCAGG - Intronic
1143775913 17:9198649-9198671 CTGTCATTACTGAGACCAGCTGG - Intronic
1144647759 17:16987157-16987179 CAGTGTTTAGTCAGAGCAGCTGG - Intergenic
1151413648 17:73947595-73947617 CAGGGTTTAGTGAGAGAAGGAGG + Intergenic
1152452279 17:80389266-80389288 CTGGGGTTTCTGAGCACAGCTGG + Exonic
1152663281 17:81552739-81552761 CTGGGCTCTCGGAGAGCAGCTGG + Intronic
1152728556 17:81959334-81959356 CCGGGTTTACTAAGAGCAAGGGG - Intronic
1152984867 18:312247-312269 CTGGGTTGACTGATCTCAGCTGG + Intergenic
1153555913 18:6313034-6313056 CTTGGTTTACTTGGAGCAGGAGG - Intronic
1156442922 18:37209725-37209747 CTGGGTTGATTGAGAGGAGTGGG + Intronic
1158477350 18:57791945-57791967 CTGTGTTTACTGCCAGCACCTGG + Intronic
1160219000 18:76958799-76958821 GTGGGTGTAATGAAAGCAGCAGG - Intronic
1161144811 19:2671235-2671257 GTGGGTTGTCTGAGATCAGCTGG - Intronic
1163033076 19:14556934-14556956 TTGGGTTCACTGTGACCAGCTGG + Intronic
1163362569 19:16856404-16856426 GTGGGGTTCCTGAGAGCTGCAGG + Intronic
1163846650 19:19642005-19642027 CTGGGTCTTCTGAGAGTAGAGGG + Exonic
1164415025 19:28039818-28039840 CTGGAATTGCTGAGTGCAGCTGG - Intergenic
1164759575 19:30718971-30718993 CTGGCTTTTCTGGGAGCAGCCGG - Intergenic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1168063336 19:53906397-53906419 CTGGATTGACTGGGAGCGGCTGG + Exonic
1202678594 1_KI270711v1_random:30056-30078 CTGTTTTAACTGAGAGCAGGTGG - Intergenic
926505851 2:13714590-13714612 CTCTGTTTTCTTAGAGCAGCTGG + Intergenic
929168463 2:38907072-38907094 CTTGGTTGACAGAGAGCAGAGGG + Intronic
930523169 2:52493798-52493820 CTGGGTAAACTGAGGGCTGCAGG - Intergenic
930997696 2:57741134-57741156 CTGGTTTTAATGACACCAGCAGG + Intergenic
932888873 2:75572854-75572876 GTGGGTTTACTGGGATCAGTTGG - Intergenic
934616217 2:95772854-95772876 CTGGGGTTACTGAAGGCAGCAGG + Intergenic
934644678 2:96051706-96051728 CTGGGGTTACTGAAGGCAGCAGG - Intergenic
934838093 2:97607796-97607818 CTGGGGTTACTGAAGGCAGCAGG - Intergenic
937322089 2:120966945-120966967 CTGTGTGTACTGTGAGCAGGAGG + Intronic
939479961 2:142735429-142735451 CTTGGTTTACTGAGATCACAGGG + Intergenic
941023047 2:160430193-160430215 CTGGGTTGGCTGGGATCAGCTGG - Intronic
941885273 2:170521477-170521499 CTGACTTTACTGAGAACACCAGG + Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
944634065 2:201657381-201657403 CTCTGTCTACTGAGAGCACCTGG - Intronic
944672764 2:202009100-202009122 CAGGCTTTGCTGACAGCAGCTGG + Intergenic
945418149 2:209600435-209600457 CTGGGGGGACTGACAGCAGCTGG - Intronic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948937098 2:241173666-241173688 CTGGGTTTTCAGAGAGAAACCGG - Intronic
1172929120 20:38570280-38570302 CTGGGATGACTGAGACCAACTGG - Intronic
1173607718 20:44343487-44343509 CTGGGTATAATGGGAGCAGGTGG - Exonic
1174214934 20:48909100-48909122 CTGGGTTGACTAGGATCAGCTGG - Intergenic
1176025780 20:62984917-62984939 CTGGGTTTACAGAGAGGACGAGG + Intergenic
1178327243 21:31655841-31655863 GTGGGTGGACTGAGAGCAGATGG - Intergenic
1179791490 21:43758383-43758405 CGGGGGTTTCTGAGAGCAGATGG + Exonic
1180200395 21:46220660-46220682 CTAGGTTTTCTTGGAGCAGCAGG + Intronic
1180867779 22:19129282-19129304 CTGGATTCACAGGGAGCAGCTGG - Intergenic
1181094249 22:20495261-20495283 CCCGGTTTCCTGAGAGGAGCCGG - Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1183299712 22:37052834-37052856 CAGGGTTTGCTGTGAGCATCCGG - Intronic
1184266441 22:43349409-43349431 CTGGGAGTCCTGAGAGAAGCAGG - Intergenic
1185149830 22:49157912-49157934 CCGGTTTAACAGAGAGCAGCCGG + Intergenic
1185331288 22:50253117-50253139 CTGAGGTTTCTGAGAGCACCGGG + Exonic
950866943 3:16197009-16197031 CTGGGGTTCCTGGGTGCAGCTGG + Intronic
953157188 3:40386270-40386292 CTGGGGTCACTCAGAGGAGCCGG + Intergenic
954294867 3:49668657-49668679 GTGGGTGTACTCAGAGCAGAGGG + Exonic
957178635 3:76847290-76847312 ATGGGTTTAATGAGGCCAGCTGG + Intronic
959144925 3:102533038-102533060 ATGGGTTTACTGTGTTCAGCTGG + Intergenic
960466089 3:117997726-117997748 CTGTGTTTGCTGAGAGCAGAGGG - Intergenic
962019324 3:131480616-131480638 CTGGGTTTATTTAGTGCAGTTGG - Intronic
963268869 3:143266189-143266211 CTGGGGTCACTGAGAGCAAATGG + Exonic
964477534 3:157110247-157110269 ATGAGTTTACACAGAGCAGCTGG - Intergenic
964780873 3:160336251-160336273 CTGGGTCTCCTGTGAGCACCAGG + Intronic
967421517 3:189278316-189278338 CTGGGTGGAGAGAGAGCAGCAGG + Intronic
967756630 3:193177663-193177685 CTGGCTTAACTGAAGGCAGCTGG + Intergenic
969516013 4:7648626-7648648 CTGGGTCTACTGAGGGCGGGCGG + Intronic
971308061 4:25501061-25501083 CTGGAACTGCTGAGAGCAGCTGG + Intergenic
973295094 4:48509926-48509948 AGGGTTTTCCTGAGAGCAGCAGG - Intronic
976334154 4:83866129-83866151 CTGGTAATACTAAGAGCAGCCGG + Intergenic
990538617 5:56749774-56749796 CTGGGCTTACTGATAGCAAAGGG + Intergenic
997213465 5:132091868-132091890 CTGGGCTCACTGATAGCAGTAGG - Intergenic
998641059 5:144011799-144011821 CTGGGTGGACTCAGAGCAGATGG + Intergenic
1001099331 5:168801221-168801243 TTGGATTTTCTGAGAGCACCAGG - Intronic
1002668628 5:180846609-180846631 TTGGGTTTTCTGAGAGGAGTAGG - Intergenic
1003384405 6:5654029-5654051 CTGGGTTCTCTGACAGCATCAGG + Intronic
1003665976 6:8111685-8111707 CTGTGTTATCTGAGAGCAGTTGG + Intergenic
1003880589 6:10476503-10476525 CTGGGCTTACTGATAGCAAGTGG + Intergenic
1004094631 6:12540395-12540417 CTGATTTTACTTAGATCAGCTGG - Intergenic
1005430989 6:25756612-25756634 CTGGCGTTAATGAGAGCAGTGGG - Intronic
1006174133 6:32111682-32111704 CTGAGGTTACAGAGAACAGCCGG - Intronic
1007629071 6:43262827-43262849 CTGGGCTGGCTGAGAGGAGCAGG - Exonic
1007924490 6:45640535-45640557 CTGGCTTTACTTAGAGAAGTTGG - Intronic
1011849534 6:91608892-91608914 GTGGGTTCACTGAGCTCAGCTGG - Intergenic
1013418234 6:109943706-109943728 CTGGGTTTACAAAGTGCTGCAGG + Intergenic
1013658368 6:112269077-112269099 CTGGGTTTAATGATTTCAGCAGG - Intergenic
1013668834 6:112376238-112376260 GTCGGTTTCCTCAGAGCAGCAGG + Intergenic
1015794816 6:137001105-137001127 TTGGGTTTATTGCGAGCAGGAGG - Exonic
1016206241 6:141471871-141471893 CAGAGTTTACTGACAGCAGTGGG - Intergenic
1017634221 6:156427680-156427702 CTGGGTTGACTGAGCTCAGCTGG - Intergenic
1018812567 6:167308435-167308457 GTGGGTTTTCTGGGAGCAGCAGG + Intronic
1021482027 7:21128762-21128784 CTGGGCTGACTGGCAGCAGCAGG - Intergenic
1021671960 7:23043599-23043621 CTTGGCTAACTGAGATCAGCAGG - Intergenic
1022783362 7:33609783-33609805 CTGGCTTAAGTGAGAGCAGTGGG + Intergenic
1023638381 7:42236253-42236275 CCGCGTTTACACAGAGCAGCAGG - Intronic
1024879625 7:54070696-54070718 CTGTGGTTGCTGTGAGCAGCAGG + Intergenic
1027545631 7:79524322-79524344 CTGTGGTTACTTAGAGCAGCTGG + Intergenic
1029179199 7:98687788-98687810 CTGGGCTTAGAGAGAGGAGCAGG - Intergenic
1031987776 7:128174491-128174513 CGGTGTGTGCTGAGAGCAGCGGG + Intergenic
1034374523 7:150630553-150630575 CTGTGTTCCCTGGGAGCAGCAGG + Intronic
1034401515 7:150864596-150864618 CAGGGAGAACTGAGAGCAGCAGG + Intergenic
1036226146 8:6959402-6959424 CTGGGGATACAGAGAGCATCAGG + Intergenic
1039254461 8:35703979-35704001 CTAGTTTTCCTGAGAGCAGGTGG - Intronic
1040973968 8:53169713-53169735 CTGGGTTTATTTGTAGCAGCTGG + Intergenic
1041321635 8:56619737-56619759 CTGAGCTTCCTGAGAGCAGCTGG - Intergenic
1042708156 8:71684294-71684316 CTGGGTTGACAGGGAGCAGGAGG - Intergenic
1045731719 8:105249279-105249301 CTGGTTATACTGAGGGGAGCAGG + Intronic
1047027565 8:120840661-120840683 CTGGGACTATTGAGAGCAGAGGG + Intergenic
1052096533 9:24391026-24391048 CTGGCTCTAAAGAGAGCAGCGGG - Intergenic
1055877573 9:80961814-80961836 CAGGGTTTATTGAGAGCAAAGGG - Intergenic
1056537421 9:87542009-87542031 CTGAATTTAATGACAGCAGCAGG + Intronic
1056739957 9:89245976-89245998 CTGGGCTTACTCTGAGCAGCTGG + Intergenic
1056834541 9:89943814-89943836 CTGGGTTTCCTTATAGCATCTGG + Intergenic
1059176912 9:112175817-112175839 CCGGGTGTCCTCAGAGCAGCGGG - Intergenic
1059238230 9:112780483-112780505 GTGGGTTTGCTGATGGCAGCTGG + Intronic
1059427001 9:114227526-114227548 CTGGGGTTACTGTGAGCAGCTGG + Intronic
1059954645 9:119502777-119502799 CTGGCTTTGAAGAGAGCAGCAGG + Intronic
1060665898 9:125431963-125431985 CTGGCCTTGCTGAGAGCCGCTGG - Intergenic
1186442379 X:9597311-9597333 CTGGGTTTAAGGAGAGCAGCAGG - Intronic
1189380374 X:40498612-40498634 CTGACTTTCCTGAGAGGAGCTGG + Intergenic
1190105293 X:47556346-47556368 CTGGGTTGGCAGAGAGGAGCTGG + Intergenic
1195917893 X:109953764-109953786 CTGGGTTGAAAGAGAGCAGGTGG - Intergenic