ID: 1096840775

View in Genome Browser
Species Human (GRCh38)
Location 12:54378353-54378375
Sequence GTGTCCAAGCCAGCATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096840775 Original CRISPR GTGTCCAAGCCAGCATCCCA GGG (reversed) Intronic
900087115 1:904037-904059 GTGCCCAGCCCAGCATCCCGGGG + Intergenic
900297463 1:1959085-1959107 GTGTCCGAGCCAGCATTTCTCGG - Intronic
904095539 1:27974229-27974251 GTGTTCTCGCCAGCATTCCATGG + Exonic
907514723 1:54986344-54986366 CCGTCAAGGCCAGCATCCCAGGG + Exonic
908044799 1:60157039-60157061 GTGGCCAAGTCAGCCTCCCGAGG - Intergenic
908871046 1:68612921-68612943 ATGTCCCAGCCCTCATCCCATGG - Intergenic
912214584 1:107593522-107593544 CTGTCCAACCCAGTATCCCAAGG + Intronic
915580065 1:156808252-156808274 CTAGCCAAGCCAGAATCCCAGGG - Intronic
917456573 1:175191182-175191204 GTGTGCAGGCCAGTATACCAGGG - Intronic
917736084 1:177921529-177921551 GTGCCCAAACCAGCTTCTCAGGG + Intergenic
918682157 1:187369195-187369217 GTGTCCAAATCAGGATACCAAGG - Intergenic
1063378121 10:5566267-5566289 CTTTCAAAGCCAGCAACCCAGGG - Intergenic
1063391220 10:5650956-5650978 GTGTCCAAGCCAGGGTTCCCTGG - Intronic
1065428218 10:25627707-25627729 GTGTCCAAGCCTGAAACCCATGG - Intergenic
1075004532 10:118820496-118820518 GTGGCCAAGCTGGCATCTCATGG + Intergenic
1075094362 10:119461191-119461213 GGCTCAAAGCCAGCATCCCTGGG + Intergenic
1076508719 10:130997416-130997438 GGGACCAACCCAGCCTCCCAGGG + Intergenic
1076544536 10:131236452-131236474 GTGGCCACATCAGCATCCCAGGG + Intronic
1076875469 10:133213571-133213593 GTGTCCAAGGCAGGGTCCCAGGG - Intronic
1079110867 11:17604434-17604456 ATGCCCACGCCTGCATCCCATGG + Intronic
1081731324 11:45373768-45373790 GGGATCAAGACAGCATCCCATGG - Intergenic
1084218585 11:67664653-67664675 GGCTCCAGGCCAGGATCCCAAGG + Intronic
1084468754 11:69342887-69342909 GTGTCCCTGCCACCATCCCCAGG - Intronic
1084550619 11:69839612-69839634 GTGGCCAAGCCAGCCTGCCTGGG - Intergenic
1084972344 11:72778764-72778786 GTATCCTTGCCTGCATCCCAGGG + Intronic
1085461491 11:76696666-76696688 GCGTCCCAGCCAGCGCCCCAGGG + Intergenic
1085744438 11:79102600-79102622 GTGTGCAAGGCACCATGCCAAGG - Intronic
1089168647 11:116497478-116497500 GTGTGCAACCCAGCGTCTCAAGG - Intergenic
1090847893 11:130546071-130546093 GCCTCCAAGCCTGCCTCCCAAGG - Intergenic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1097789191 12:63796071-63796093 GTTTCCAATCCAGAATCACACGG + Intronic
1100070978 12:90717480-90717502 GTGTCCATGCCTCCTTCCCAAGG + Intergenic
1102447552 12:113015248-113015270 GTATCCAAGCCAGCGTCCCTTGG + Intergenic
1102706964 12:114889993-114890015 CTGGTCAACCCAGCATCCCACGG + Intergenic
1104286737 12:127431002-127431024 GTGTCCCAGGCTCCATCCCAAGG + Intergenic
1104607141 12:130198429-130198451 GTGTTCTAGCCAGCACCCCCGGG - Intergenic
1104919730 12:132284624-132284646 GTGTCCAAGCCTCCATGCCCAGG + Intronic
1109994344 13:70103712-70103734 TTGTGCAAGCCAGAATTCCAGGG - Intronic
1111683843 13:91477378-91477400 TTGTTCAAGCCAGAAACCCAAGG - Intronic
1112302051 13:98239680-98239702 GTGGCCCAGCCAGAAACCCAAGG - Intronic
1115328456 14:32167968-32167990 GTGTCTGAGTCAGCTTCCCAGGG + Intergenic
1116866318 14:50034597-50034619 GTGTCCAACACAGGATCGCATGG + Intergenic
1117630876 14:57690124-57690146 TTGACCAAGTCAGCATCTCATGG + Intronic
1118391333 14:65298316-65298338 GTTTCCCACCCAGCATCCCATGG - Intergenic
1119034117 14:71215531-71215553 GTGTCCACTCCACCATCCAATGG + Intergenic
1119588746 14:75863973-75863995 CTGTCCAAGCCAGGATGGCACGG - Intronic
1122357818 14:101134557-101134579 GTCTGCAAGCCTGCCTCCCAGGG - Intergenic
1125827529 15:42689071-42689093 GTGACCAAGCCAGCAAGCCAAGG + Exonic
1131636373 15:94236994-94237016 GGCACCAAGCCAGCAGCCCAAGG - Intronic
1132289296 15:100688340-100688362 GTGTCCCACCCAGGACCCCAGGG + Intergenic
1133180217 16:4048749-4048771 CTGTCCAAGCCAGCATCTAGTGG - Intronic
1133756704 16:8767407-8767429 GGGTGCACGCCTGCATCCCAGGG - Intronic
1133770627 16:8865559-8865581 CTTCCCCAGCCAGCATCCCATGG - Intronic
1134089057 16:11380923-11380945 GAGTCCAAGGCTGCCTCCCAAGG + Intronic
1134641057 16:15829620-15829642 GTGTCCCAGCCGGCATCTCATGG + Intronic
1135415486 16:22265468-22265490 CTCTCCAAGCCTGGATCCCAGGG + Intronic
1136280876 16:29210464-29210486 GTGTCCCAGCCAGCTCCCCCAGG - Intergenic
1138392594 16:56681557-56681579 GAGTTCAAGCCACCAGCCCAGGG - Intronic
1139558326 16:67726693-67726715 GTGTCCCAGCCACCAGGCCATGG + Intronic
1140937261 16:79684806-79684828 GTGTCCCAGCCAGAGTCCAAAGG - Intergenic
1142085232 16:88176386-88176408 GTGTCCCAGCCAGCTCCCCCAGG - Intergenic
1142147522 16:88498839-88498861 GTGTCCACGCCAACGACCCAGGG - Intronic
1145064657 17:19753921-19753943 CTGACAAAGCCAGCATCCCTGGG - Intergenic
1148579788 17:48735537-48735559 GAGTCCTATCCAGTATCCCAGGG - Intergenic
1152271299 17:79326457-79326479 GACCCCAGGCCAGCATCCCATGG - Intronic
1156521478 18:37725550-37725572 CTGTTCAAGCAAGCAGCCCAAGG + Intergenic
1164050231 19:21579688-21579710 GTGTTATGGCCAGCATCCCAAGG - Intergenic
1164513619 19:28916367-28916389 GGGGCCAAGCCAGCACCCCCTGG + Intergenic
1164702629 19:30296605-30296627 CTGTCCAAGCCAGCCTTCCATGG - Intronic
1165999832 19:39871327-39871349 GTGTCCAAGACACCTTCCCCTGG - Intronic
1167593970 19:50417944-50417966 GTGACCTTGCAAGCATCCCATGG + Exonic
1167775036 19:51549145-51549167 GTGTCCTGGCCAACATCCAAGGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925092904 2:1169390-1169412 GCGTCTAAGCCAGCTTCCCTGGG + Intronic
925738664 2:6986138-6986160 CTGTCCCAGCCAGCATCCTCGGG + Intronic
926716507 2:15928513-15928535 GTGGCCTAGCCATCATCCTAGGG + Intergenic
929284777 2:40123146-40123168 GTGTCCAAGAGAGAATCCAAGGG + Intronic
930825514 2:55693295-55693317 GGGTCCGGGCCAGCATCCCGGGG + Intronic
933536165 2:83577741-83577763 GTGTTCAAGCCAGCAGCTGAAGG + Intergenic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
936030585 2:109067464-109067486 GGGGCCATGCCACCATCCCAGGG + Intergenic
937236364 2:120433819-120433841 GTGTCCAACACAGAATCCAAAGG - Intergenic
940072412 2:149703356-149703378 TTTTCCAAGCAAGCATTCCAAGG + Intergenic
942373186 2:175308302-175308324 CAGTACAATCCAGCATCCCATGG + Intergenic
945419940 2:209622408-209622430 GTGTCCTTCCCAGCATCACAAGG - Intronic
948537747 2:238658732-238658754 GTGTCCAGGAGAGCATGCCATGG - Intergenic
948547272 2:238741836-238741858 GTCTCCAGGCCCGCTTCCCATGG + Intergenic
1170392292 20:15888899-15888921 GAGTCTAAACCAGCCTCCCAAGG + Intronic
1172136369 20:32689453-32689475 GCCTCCAAGCCTGCCTCCCAGGG - Intergenic
1172937062 20:38628041-38628063 GTGTCCAGGACAGCAGCCCAGGG + Intronic
1176024588 20:62979161-62979183 GTGTTTTTGCCAGCATCCCATGG + Intergenic
1178352135 21:31879778-31879800 GTGCCCAAGCCTCCTTCCCATGG - Intronic
1179631583 21:42682030-42682052 CTGTCCAAGCCCCCATCCCTAGG + Intronic
1179882978 21:44301020-44301042 GGGGCCCAGCCAGCACCCCAAGG + Intronic
1181547199 22:23608845-23608867 GCCTCCACGCCAGCATCCCTGGG + Intronic
1181754728 22:25015737-25015759 GTGTCCTACCCTACATCCCATGG + Intronic
1181917520 22:26292747-26292769 GGGTCCCAGCCAGCGTCCCAGGG + Exonic
950555833 3:13695469-13695491 GGGTCCAGGCCAGAATCCTAGGG - Intergenic
952304672 3:32135336-32135358 GTGTCCCACCCATCTTCCCACGG - Intronic
952737280 3:36703345-36703367 ATGTCCATGTCAGCAGCCCAAGG - Intergenic
953417003 3:42728273-42728295 GTGCTCATCCCAGCATCCCAGGG - Intronic
953879412 3:46683901-46683923 GGGCCCAAGCCAGAGTCCCAGGG + Intronic
954212950 3:49108584-49108606 GGCTCCAAGCCAGCACCCCCGGG - Intronic
955528695 3:59849448-59849470 GTGTCCAAACCACAATCTCATGG + Intronic
955753939 3:62209019-62209041 GCGCCAAAGCCAGCATCACATGG - Intronic
956342849 3:68246171-68246193 GTGTCCAAACAAACCTCCCAGGG + Intronic
958135414 3:89483399-89483421 ATGTCCAAGTCACCTTCCCAAGG + Intergenic
958893843 3:99808694-99808716 GGTTCCAAGTGAGCATCCCAAGG + Intergenic
961498753 3:127315500-127315522 GTTGCCAATACAGCATCCCAGGG + Intergenic
964249675 3:154698554-154698576 TTGTCCAAGCCAGAATGCAATGG + Intergenic
964541816 3:157787863-157787885 TTCTCCAAGCCAGAAACCCAGGG + Intergenic
968805253 4:2767842-2767864 CTGTCCCAGCCAGCATCCCAAGG + Intergenic
968967698 4:3777376-3777398 GAGACCAAGCAGGCATCCCATGG - Intergenic
971171040 4:24233008-24233030 GTGTCCACACAAGGATCCCAAGG + Intergenic
978035235 4:103985008-103985030 TTTTACAAGGCAGCATCCCATGG - Intergenic
982866995 4:160525718-160525740 GTATCCAAACTAGCATCACAAGG + Intergenic
984845300 4:184103207-184103229 GTGTAACAACCAGCATCCCATGG - Intronic
985606744 5:862005-862027 GTCCCCAAGCCCGCATGCCAGGG - Intronic
986608520 5:9545848-9545870 GTGTCCAAGCCAGCTCCGCGGGG + Exonic
989621296 5:43387110-43387132 GTGTTAAAACCAGCATGCCAGGG + Intronic
993280586 5:85920511-85920533 GTGGCCTTGCTAGCATCCCAAGG - Intergenic
998121528 5:139582084-139582106 GTGCTCAAGCCATCCTCCCAAGG + Intronic
998403663 5:141861870-141861892 GAGTGCAAGCAAGCAACCCAGGG + Intronic
999615793 5:153421803-153421825 GAGTCCCAGCCAGCATCTTAGGG - Intergenic
1003077188 6:2992723-2992745 GAGACCAAGACAGCAACCCATGG - Intronic
1006358214 6:33573076-33573098 GCCTCCAAGCCTGCCTCCCAAGG - Exonic
1006694134 6:35916677-35916699 CTGTCCAAACCAGCTTCCTAAGG + Intronic
1006888014 6:37398418-37398440 TTGTCCAAGGCAGAAACCCATGG - Intergenic
1007352023 6:41280923-41280945 GTGTCCAAACCAGGGGCCCAGGG + Intronic
1008090684 6:47290853-47290875 GTGTGCAAGACAGCATGCCATGG + Intronic
1008556928 6:52681523-52681545 GTGTCCAAGCCACCAGAACAAGG + Intronic
1010654499 6:78496171-78496193 GTTTCCAAACCAGCAACCCCTGG + Intergenic
1017043454 6:150325888-150325910 TGGTCCAAGCCAGCATCCTCAGG - Intergenic
1017731156 6:157317400-157317422 GTGTCCAAGTCACCAGGCCAAGG + Intronic
1019877729 7:3829645-3829667 GTGTCCAAGAGAGAAGCCCAAGG + Intronic
1021027372 7:15686204-15686226 GTTTGCCAGCCAGCATCACAGGG - Exonic
1027978842 7:85191041-85191063 CTGTCCAAGCCAGAATCTTAAGG + Intergenic
1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG + Intronic
1033393626 7:140952498-140952520 GTATACAAGTCAGCAGCCCAGGG + Intergenic
1034414509 7:150957520-150957542 GTGGTCAGGCCAGCAGCCCAGGG + Intronic
1036556499 8:9864606-9864628 TTGTCCAACCCTGCAGCCCATGG + Intergenic
1038672944 8:29596960-29596982 CTGTCCGAGTCAACATCCCAGGG - Intergenic
1039667765 8:39554333-39554355 GTGTCCATGCCAGTATTCCCTGG - Intergenic
1039764509 8:40613817-40613839 GCATCCAAGCCAGCCTCCAAAGG + Intronic
1042714539 8:71758403-71758425 GTGTCCCAGTCAGCATCTCCAGG - Intergenic
1043031375 8:75137493-75137515 GTGCCAAAGTCAGCATGCCAGGG - Intergenic
1044605619 8:94044900-94044922 GTGTCCAAGCCAGAATCTTTTGG + Intergenic
1049955718 9:690793-690815 GTTCCAAAGCCACCATCCCAGGG + Intronic
1059410199 9:114127040-114127062 GTGTCCCAGCCAGGTGCCCACGG - Intergenic
1062295300 9:135822056-135822078 GAGTCCGAGCCAGCATGGCAAGG - Exonic
1185769159 X:2752019-2752041 GTGTCGGAGCCAGCCTCCCCGGG - Intergenic
1186352207 X:8751297-8751319 GCTTCCAAGTCACCATCCCACGG - Intergenic
1187752168 X:22478741-22478763 GTGCCCAAGGGAGCATCCCGTGG + Intergenic
1188996955 X:36897881-36897903 GGGTACATGCCAGCCTCCCATGG - Intergenic
1189367621 X:40401182-40401204 ATGTCAAAGACATCATCCCAGGG - Intergenic
1189897806 X:45673654-45673676 GTGGCAATGCCAGCATCCCTGGG - Intergenic
1190062849 X:47222108-47222130 CTGTCGATGCCAGCATCCCTGGG + Intronic
1190819715 X:53961922-53961944 GTGGCCAAGCCTTGATCCCATGG - Intronic
1194639866 X:96391130-96391152 GGGTCCAGGCCAGAATTCCAAGG + Intergenic
1198092611 X:133346457-133346479 GTGACCAAGCCATCAACCAAGGG + Intronic
1200138826 X:153887259-153887281 GCATCCAAGCCAGGATGCCAGGG - Intronic