ID: 1096845281

View in Genome Browser
Species Human (GRCh38)
Location 12:54403202-54403224
Sequence GCTCTTGCTCTGATAATGTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096845271_1096845281 9 Left 1096845271 12:54403170-54403192 CCCTGCCCTGTCCTCACCTTGTC 0: 1
1: 1
2: 4
3: 84
4: 679
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845274_1096845281 3 Left 1096845274 12:54403176-54403198 CCTGTCCTCACCTTGTCCTCTAT 0: 1
1: 1
2: 1
3: 20
4: 291
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845269_1096845281 16 Left 1096845269 12:54403163-54403185 CCCTTCTCCCTGCCCTGTCCTCA 0: 1
1: 1
2: 6
3: 135
4: 1134
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845272_1096845281 8 Left 1096845272 12:54403171-54403193 CCTGCCCTGTCCTCACCTTGTCC 0: 1
1: 0
2: 4
3: 121
4: 853
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845276_1096845281 -2 Left 1096845276 12:54403181-54403203 CCTCACCTTGTCCTCTATCCGGC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845273_1096845281 4 Left 1096845273 12:54403175-54403197 CCCTGTCCTCACCTTGTCCTCTA 0: 1
1: 0
2: 1
3: 34
4: 385
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845277_1096845281 -7 Left 1096845277 12:54403186-54403208 CCTTGTCCTCTATCCGGCTCTTG 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845268_1096845281 22 Left 1096845268 12:54403157-54403179 CCAGGTCCCTTCTCCCTGCCCTG 0: 1
1: 0
2: 7
3: 106
4: 894
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845270_1096845281 15 Left 1096845270 12:54403164-54403186 CCTTCTCCCTGCCCTGTCCTCAC 0: 1
1: 0
2: 19
3: 179
4: 1657
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1096845267_1096845281 23 Left 1096845267 12:54403156-54403178 CCCAGGTCCCTTCTCCCTGCCCT 0: 1
1: 1
2: 6
3: 85
4: 709
Right 1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096845281 Original CRISPR GCTCTTGCTCTGATAATGTA GGG Exonic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902731042 1:18369027-18369049 TCTCTTGCTCTGATGATGAGTGG - Intronic
916962137 1:169899448-169899470 TCTCATACTCTGATCATGTAAGG + Intergenic
918432860 1:184480406-184480428 AATCTTGCTCTGACAATCTAAGG - Intronic
920670412 1:207999841-207999863 CCTCATCCTCTGATGATGTAGGG - Intergenic
921345434 1:214179151-214179173 CCTTTTGCTCTGATAATTTTTGG - Intergenic
1063689862 10:8276470-8276492 GCTTTTGTTCTGATAATGACTGG + Intergenic
1064190242 10:13199821-13199843 CCTATTTCTTTGATAATGTAGGG + Intronic
1065975086 10:30835151-30835173 GCTCTTGCAATGATAATAAAAGG - Intronic
1078895145 11:15591295-15591317 GCCCTTGCTCTGATAAGGGAGGG + Intergenic
1079943871 11:26716796-26716818 TCTCTTGCTCAGATTATGTAAGG + Intronic
1081050632 11:38336550-38336572 GCTCTCGCTGTTATAATGTCTGG + Intergenic
1083177210 11:60958051-60958073 GTTCTTGCTCTGTTAGTTTATGG - Intergenic
1091127151 11:133110701-133110723 GCTCCAGCTCTGATAATCTATGG + Intronic
1094384091 12:29874780-29874802 GCTCTGGCTGTGAGAATGTGAGG + Intergenic
1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG + Exonic
1099138816 12:78943392-78943414 GCTCCTGCTCTGACCATGTGAGG - Intronic
1103099208 12:118157634-118157656 GCTCTTGCTCTGACATTACACGG + Intronic
1114760997 14:25314327-25314349 CCTCTTGCTCTGGTCATGCATGG + Intergenic
1115051012 14:29063087-29063109 CCTCTGCCTCTGGTAATGTATGG - Intergenic
1121681069 14:95793035-95793057 GCTCCTGCTCTCATCATGTGAGG + Intergenic
1126750102 15:51867983-51868005 GCTCTTGCTGTGAGTATGTCAGG + Intronic
1127839867 15:62821767-62821789 GCTCTTACTCTGACAATATCAGG - Intronic
1129071725 15:72957009-72957031 GCTCTTTCACTGAAAATTTAGGG + Intergenic
1131778503 15:95828372-95828394 GCTATTGCTCTGAAAATAAATGG - Intergenic
1132279229 15:100598581-100598603 GTTCTTGCCCTGGTAATTTAAGG - Intronic
1134045440 16:11097824-11097846 GCTCCTGCTATTATAATGCAAGG - Intronic
1135732852 16:24908860-24908882 GATCTTGCTCTGATTTTGCAGGG + Exonic
1138749911 16:59407456-59407478 GCTCTTCCTCTCATAGTGTAGGG + Intergenic
1140118030 16:72059607-72059629 CCTCTTGTTCTGAGAATGAAAGG - Intronic
1143341103 17:6211757-6211779 GTTCTTGCTCTCATGAAGTAAGG + Intergenic
1144263286 17:13544267-13544289 GCTCTTCTTCTTATGATGTAAGG - Intronic
1144396859 17:14852807-14852829 GCTCCTGCTCTCATCATGTGAGG - Intergenic
1147352665 17:39863844-39863866 GCTCTTCCTCTGCAGATGTAGGG + Intronic
1147611221 17:41802971-41802993 GCTCTGGCTCTGAAAAGGAAAGG + Exonic
1147793479 17:43027186-43027208 CCTCTTACTATGATAATGTCCGG + Exonic
1148313967 17:46675999-46676021 GCTTTTGGTTTCATAATGTATGG + Intronic
1151552094 17:74828150-74828172 GCTCTGGCTCTGACACTGTGAGG - Intronic
1153535326 18:6095828-6095850 GCTCTTGCTCTGCTGCTGTTGGG - Intronic
1154326467 18:13394949-13394971 CCTCTTCCTCTGTTAGTGTATGG + Intronic
1160620376 18:80166676-80166698 TCTCGTGCTCTGAGGATGTAAGG - Intronic
1161727238 19:5936652-5936674 GCTCTTGTTGTGACAAAGTAAGG + Intronic
1161747166 19:6068058-6068080 ACTCTTGGGCTGTTAATGTATGG + Intronic
925780133 2:7374534-7374556 GAACTTGCTCTGACAATGCAGGG - Intergenic
926156384 2:10456371-10456393 GCTTTTGTTCTGATAGTGGATGG - Intergenic
928416791 2:31100134-31100156 GCTCTTCCTCTAAAAATATACGG + Intronic
930790881 2:55327102-55327124 TCTCTGGCTCTGAGAATGTCTGG + Intronic
932713325 2:74083567-74083589 TCTCTTGCTCTGCTCAGGTATGG + Intronic
936969768 2:118165625-118165647 GCTCTTCCTGTGATAGTGAATGG + Intergenic
940474532 2:154145682-154145704 CCTCTTCCACTAATAATGTAAGG - Intronic
942665605 2:178313363-178313385 ACTATGGCTCTGAGAATGTAGGG + Intronic
942671108 2:178377257-178377279 GCTCCTGCTCTGGTCATGTGAGG - Intronic
1169299394 20:4428994-4429016 GTTCTTGCTCTGGTATTGCATGG - Intergenic
1172953180 20:38735403-38735425 GCTCTTGCTCTCACCATGTGAGG + Intergenic
1175348195 20:58298106-58298128 GCTCCTGCTCTGCTTATGTTTGG - Intergenic
1177789950 21:25712233-25712255 GTTCTTGCTGAGAAAATGTATGG + Intronic
949677715 3:6476137-6476159 ACTCTTGCTATGATGCTGTAAGG - Intergenic
951034547 3:17918864-17918886 GATTTTGCACTAATAATGTAAGG - Intronic
956147036 3:66200592-66200614 TCTTTTGCTCTTATAAGGTATGG - Intronic
956524690 3:70144707-70144729 GCTGTTCCTGTGATAATGAATGG + Intergenic
956531301 3:70222172-70222194 TCTCTTTCTCTGAAAATCTAAGG + Intergenic
958804077 3:98788398-98788420 GCTGCTGTTCTGATAATGAAAGG - Exonic
959298570 3:104570451-104570473 CCTTTGGCTCTGAAAATGTAAGG - Intergenic
960631800 3:119739730-119739752 GCTCTTTCATTTATAATGTAGGG - Intronic
969375354 4:6760070-6760092 ACTCTTGCTCTGAAAACATAAGG + Intergenic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
977314530 4:95429029-95429051 GCTCTTGCTCTGTTTGTTTAAGG + Intronic
979019801 4:115481789-115481811 GCTCTTGCTGTGGCCATGTAAGG + Intergenic
981791868 4:148546732-148546754 GCTCTAGTTCTGAAAATTTAGGG + Intergenic
983304204 4:165965617-165965639 TCTCCTCCTCTGATCATGTAGGG - Intronic
986457771 5:7937364-7937386 ACTCCTGCTCTGACCATGTAAGG + Intergenic
986945877 5:13018953-13018975 TCTATTGCTCTGACAATGGATGG - Intergenic
987594899 5:19985237-19985259 CCTTTTGCTTTGATAATGAATGG - Intronic
988705850 5:33725320-33725342 TCTCTTTCTCTGATAGTTTAAGG + Intronic
988846640 5:35134326-35134348 GATCTTGCTGTGATAATCCAAGG - Intronic
992333634 5:75742786-75742808 GTTGTTGCACTGGTAATGTAAGG + Intergenic
1001091872 5:168747761-168747783 GCTCCTGTTCTGAGAATGAATGG + Intronic
1001121505 5:168984601-168984623 CCTCTTGCTGTGAAAATGTCAGG + Intronic
1004584586 6:16987221-16987243 GCTCTTGCTCTGATGCTGAGGGG - Intergenic
1009924285 6:70101042-70101064 TTTCTTGCTCTGAAAATGTCAGG - Intronic
1010630630 6:78193136-78193158 CCTCCTGCTCTGACCATGTAAGG - Intergenic
1013731402 6:113172423-113172445 GCTCTTGCTCTTGCAATGTATGG - Intergenic
1016338497 6:143034884-143034906 GGTCGAGCTCTGATAATGGATGG - Intergenic
1019303015 7:318471-318493 GCTCTTGCCATGACAATGCAGGG + Intergenic
1021018422 7:15564889-15564911 CCTCCTGCTCTGGTCATGTAAGG + Intergenic
1021504330 7:21364581-21364603 GCTAGTGCTCTGTAAATGTAAGG - Intergenic
1024695253 7:51849303-51849325 GCTCTTGCTCAGAGAATCTTTGG + Intergenic
1024973600 7:55093029-55093051 GCTCTTGTTTTGAAAATGCAGGG - Intronic
1030879691 7:114862047-114862069 CATTTTGCTCTGATAGTGTATGG + Intergenic
1032846359 7:135754976-135754998 GCTCTTGCTCTGTAATTGGAGGG + Intergenic
1037032354 8:14124604-14124626 TCTCTTGCTCTGACATTGTTAGG + Intronic
1037657187 8:20895032-20895054 GCTATTACACTGATGATGTATGG + Intergenic
1040627169 8:49161995-49162017 GGTCTTACTCTGAGAATCTAGGG + Intergenic
1046633983 8:116651485-116651507 GCTCTTTCTCAAATAATGGAAGG + Intronic
1049387649 8:142352291-142352313 GATGTTTCTCTGATAATGAATGG - Intronic
1050917332 9:11154033-11154055 GCTCTTTCTTTGATACTATATGG + Intergenic
1053017005 9:34667607-34667629 GCTCTTGCTCTGGGAAAGGAAGG + Intergenic
1053614344 9:39747813-39747835 GCTATTGCTCTGAAAATTTCTGG + Intergenic
1054239173 9:62594579-62594601 GCTATTGCTCTGAAAATTTCTGG - Intergenic
1056326463 9:85483666-85483688 GCTTTTGCTCTGCAAATGAAGGG - Intergenic
1057753305 9:97809712-97809734 GTTTTTGCTATGATACTGTAAGG + Intergenic
1058645008 9:107123334-107123356 TTTCTTTCTCTGTTAATGTATGG - Intergenic
1058816071 9:108683997-108684019 TCTCTTTCTCTTATACTGTAAGG - Intergenic
1058836118 9:108859817-108859839 GCTTTTGCTCAGAGAATGTGAGG + Intergenic
1059439547 9:114299268-114299290 GCTCCTGGTCTTATAATATAAGG + Intronic
1059736342 9:117103635-117103657 GCTCTTGCTATCATGATGGATGG + Intronic
1061651521 9:132054276-132054298 GCTCCTGCTCTGACCATGTGAGG + Intronic
1186941809 X:14517056-14517078 ACTGTTGATCTGGTAATGTATGG - Intergenic
1192345640 X:70302288-70302310 GCTATTCCTGTGATAATGAAAGG - Exonic
1201261018 Y:12158920-12158942 GATCTAGCTATGATAATGAAAGG - Intergenic